TkA07G021040 | RubberDandelionOmics

Gene overview

TkA07G021040

Reference: TK1151 Chr: Chr07 Coordinates: 5713406-5722716 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1927 bp · TkA07G021040|TK1151|cDNA

CTTTTACGAAATTACTTACTTATAACAGAACATGGGCCACATGGGGCGTATTTGCCTTCTGAAATCAACAGTCCAATGGTCATTCTTGCTGTACTTCCACAATCAATCGGATTACTCTTCCGCTCACCGAGAAAATCAAATTCCTCCATTACCGACCTTACCACCAGAAACCGTGAATTCGATTTCGATTCCACTAGCTACGCCCAAATGATCCATAAATTCGCACGCATCTGAGTTCCGGCTCGGTTTTCGGTGGGTCA...

CDS

Download CDS FASTA

1398 bp · TkA07G021040|TK1151|CDS

ATGATTGATCAGTTCATCAATTTTGTCATTCGACCTCCCAGGGCTGACTACAATCCTGACCAGTATTTATGGGAGAAAGACTTCACTCTTGCTGGAAGAAAATTCAAAAGACAAGACCTTGAGCTCAGAAATAGTAGAGGGCATATACTGAGATGTAGCCATTACATGCCTTCACCTTTCCCTGATGACAACACTTCTCTTCCTTGTGTCATATACTGCCATGGAAACAGTGGATGTAGGGCGGATGCAAATGAGGCTGC...

Protein

Download Protein FASTA

465 aa · TkA07G021040|TK1151|PROTEIN

MIDQFINFVIRPPRADYNPDQYLWEKDFTLAGRKFKRQDLELRNSRGHILRCSHYMPSPFPDDNTSLPCVIYCHGNSGCRADANEAAVILLPSNITVFTLDFSGSGLSDGNYVSLGWHESDDLKVVVSYLRSNEQTSRIGLWGRSMGAVTSLLYGAEDPSIAGMVLDSAFSNLFNLMLELVDVYKIRLPKFTVKVALQYMRRVISKKAKFDIMDINALKVAPKTFIPALFGHAKGDKFIQPHHSDLISTSYAGDKNVIKF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G021040`
TK1151 ID	TkA07G021040
OH-1004 ID	LXL04_026960
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 91.398 / OH-1004 91.595 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G021040

Location Chr07:5713406-5722716 (-)

Description Similar to yqkD: Uncharacterized protein YqkD (Bacillus subtilis (strain 168)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52155`	Uncharacterized protein At3g52155, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026960 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function

KEGG gene cross-reference

bsu:BSU23640

gga:418763

xla:432053

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.293

Rank 1 · TkA07G021040 · TK1151

Cell membrane0.210

Rank 2 · TkA07G021040 · TK1151

Golgi apparatus0.193

Rank 3 · TkA07G021040 · TK1151

Nucleus0.187

Rank 4 · TkA07G021040 · TK1151

Endoplasmic reticulum0.187

Rank 5 · TkA07G021040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_168-191 aa

PF12146Hydrolase_469-175 aa

PF12697Abhydrolase_690-174 aa

PF02129Peptidase_S1597-175 aa

PF00326Peptidase_S9104-157 aa

PF00756Esterase126-165 aa

PF00561Abhydrolase_1189-248 aa

PF12146Hydrolase_4217-250 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G021040	`PF00561`	Abhydrolase_1	68	191	1.5e-06	28.8
TkA07G021040	`PF12146`	Hydrolase_4	69	175	2.3e-11	44.2
TkA07G021040	`PF12697`	Abhydrolase_6	90	174	0.021	16.2
TkA07G021040	`PF02129`	Peptidase_S15	97	175	4.2e-05	24.1
TkA07G021040	`PF00326`	Peptidase_S9	104	157	0.057	13.6
TkA07G021040	`PF00756`	Esterase	126	165	0.091	13.2
TkA07G021040	`PF00561`	Abhydrolase_1	189	248	1.5e-06	28.8
TkA07G021040	`PF12146`	Hydrolase_4	217	250	2.3e-11	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BY1`	Arabidopsis thaliana	sp\|Q94BY1\|Y3515_ARATH Uncharacterized protein At3g52155, chloroplastic	69.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card