TkA07G010030 | RubberDandelionOmics

Gene overview

TkA07G010030

Reference: TK1151 Chr: Chr07 Coordinates: 2755304-2759091 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1949 bp · TkA07G010030|TK1151|cDNA

GTAAGATATGGGGGTTGGTATGAGGGCGTTAGGAAATTGGGAGTCTTGAACACCCACCTACTCTCTTCCTCCTCCATTTCAGCTCTCAATTCCCACTTCTCCACCTCCAAAATCTACTTAAATCCACCCTACCTATTACGTGTTCTTGGTGTAAGAACACACAGTTACGGAAAATGGCGACTCACATTAACAACGTTGCCCAGAATCTCCAAACTGCCAATTTCACTTCCAATCTTTCAAAATCCCCAAATCCCTCTTCC...

CDS

Download CDS FASTA

1557 bp · TkA07G010030|TK1151|CDS

ATGGCGACTCACATTAACAACGTTGCCCAGAATCTCCAAACTGCCAATTTCACTTCCAATCTTTCAAAATCCCCAAATCCCTCTTCCAAATCATTGTCTTTCTTATCTTTTGGATCGAAATACAGAACCCCAATTACTCAAATCTCTGTTTCTTCTAGTAAAAACATTAGGAGAAAATCTTTAACCGTTTCTGCTTCTGTTGCCACCACGGAGAAGCCGTCGACGGTACCCGAGATTGTCTTGCAACCCATCAAAGAGAT...

Protein

Download Protein FASTA

518 aa · TkA07G010030|TK1151|PROTEIN

MATHINNVAQNLQTANFTSNLSKSPNPSSKSLSFLSFGSKYRTPITQISVSSSKNIRRKSLTVSASVATTEKPSTVPEIVLQPIKEISGTVNLPGSKSLSNRILLLAALSEGTTIVDNLLNSDDVHYMLGALRTLGLRVEEDGAIKRAIVEGCGGLFPVGKEGKDEIQLFLGNAGTAMRPLTAAVTAAGGNSSYILDGVPRMRERPIGDLVTGLKQLGANVDCTLGTNCPPVRVVGGGGLPGGKVKLSGSISSQYLTALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G010030`
TK1151 ID	TkA07G010030
OH-1004 ID	LXL04_026839
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G010030

Location Chr07:2755304-2759091 (-)

Description Similar to 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45300`	Catalyzes the transfer of the enolpyruvyl moiety of phosphoenolpyruvate (PEP) to the 5-hydroxyl of shikimate-3-phosphate (S3P) to produce enolpyruvyl shikimate-3-phosphate and inorganic phosphate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026839 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0008652 amino acid biosynthetic process Biological Process

GO:0009073 aromatic amino acid family biosynthetic process Biological Process

GO:0009423 chorismate biosynthetic process Biological Process

GO:0009635 response to herbicide Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

GO:0018920 glyphosate metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003866 3-phosphoshikimate 1-carboxyvinyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G45300

nta:107813883

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.975

Rank 1 · TkA07G010030 · TK1151

Mitochondrion0.051

Rank 2 · TkA07G010030 · TK1151

Cytoplasm0.024

Rank 3 · TkA07G010030 · TK1151

Nucleus0.020

Rank 4 · TkA07G010030 · TK1151

Peroxisome0.014

Rank 5 · TkA07G010030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00275EPSP_synthase82-512 aa

PF10157BORCS6392-446 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G010030	`PF00275`	EPSP_synthase	82	512	9.3e-141	470.0
TkA07G010030	`PF10157`	BORCS6	392	446	0.18	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P05466`	Arabidopsis thaliana	sp\|P05466\|AROA_ARATH 3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic	75.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card