TkA06G476590 | RubberDandelionOmics

Gene overview

TkA06G476590

Reference: TK1151 Chr: Chr06 Coordinates: 118100465-118103279 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1881 bp · TkA06G476590|TK1151|cDNA

CAGAAAATGAAACGTCTGCGCGCCATCTGCGTGGTACAAACATAGACCTTCCACCTCTAGTCTCTTCTAACTTTTAACGAAACAAAAAATTGAAAAGGAAACCTCCCACCCCCGAAACCCCCTTTCTTCTTTCTCCATCCCGATCGAAAATCAGGTCTGCTTCTTCGCCTTTTCTTCTTCGCTGCTGCTGCATCGCCGACGCATCAGAGGGCTTCTTCGCGACCACCTCTCCTCTGGTCAACCCTCCACTTCTCCTTCGC...

CDS

Download CDS FASTA

1260 bp · TkA06G476590|TK1151|CDS

ATGTTAGAGCAGTTACTGATTTTCACCAGAGGAGGATTAATCCTCTGGACATGCAAAGAGCTAGGAAACGCCCTAAGAGGATCACCAATCGACACCTTAATCCGTTCCTGCCTTTTGGAGGAGCGATCTGGTGCAGCATCATACAACTATGATGTACCTGGAGTTTCCTACACTCTCAAATGGACATTCCACAATGAGCTAGGCCTCGTCTTTGTTGCTGTGTATCAAAAGATTCTCCATCTTTTATACGTGGACGACCT...

Protein

Download Protein FASTA

420 aa · TkA06G476590|TK1151|PROTEIN

MLEQLLIFTRGGLILWTCKELGNALRGSPIDTLIRSCLLEERSGAASYNYDVPGVSYTLKWTFHNELGLVFVAVYQKILHLLYVDDLLAMVKREFSEIYDPKRMSYDDFDETFRQLRKEAEARAEEMKKSKQVVSKQVSNSGKKQVQMQKSGFEGGNKKKESGNGKDGKDGDNVKNVSENGHANGEVAESRGISRVNGKENGYSNTNGGAFDVNKLQKLRSKGGKKVNSNNGVVVNKVSKEEPKKKPAKKNRVWDDSSPK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G476590`
TK1151 ID	TkA06G476590
OH-1004 ID	LXL04_022560
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 66.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G476590`
Location	Chr06:118100465-118103279 (+)
Description	Similar to Srpra: Signal recognition particle receptor subunit alpha
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022560` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006613 cotranslational protein targeting to membrane Biological Process GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process GO:0006617 SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition Biological Process GO:0006886 intracellular protein transport Biological Process GO:0045047 protein targeting to ER Biological Process GO:0050708 regulation of protein secretion Biological Process GO:0005785 signal recognition particle receptor complex Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0012505 endomembrane system Cellular Component GO:0016020 membrane Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	bta:281504 dme:Dmel_CG2522 hsa:6734 mmu:67398 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.281

Rank 1 · TkA06G476590 · TK1151

Cytoplasm0.262

Rank 2 · TkA06G476590 · TK1151

Nucleus0.207

Rank 3 · TkA06G476590 · TK1151

Endoplasmic reticulum0.203

Rank 4 · TkA06G476590 · TK1151

Golgi apparatus0.193

Rank 5 · TkA06G476590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04086SRP-alpha_N28-124 aa

PF01451LMWPc87-132 aa

PF02881SRP54_N104-118 aa

PF01451LMWPc248-289 aa

PF02881SRP54_N326-394 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G476590	`PF04086`	SRP-alpha_N	28	124	2.4e-31	108.8
TkA06G476590	`PF01451`	LMWPc	87	132	0.0016	19.2
TkA06G476590	`PF02881`	SRP54_N	104	118	6.1e-10	39.9
TkA06G476590	`PF01451`	LMWPc	248	289	0.0016	19.2
TkA06G476590	`PF02881`	SRP54_N	326	394	6.1e-10	39.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card