TkA06G474310 | RubberDandelionOmics

Gene overview

TkA06G474310

Reference: TK1151 Chr: Chr06 Coordinates: 117471442-117474487 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1619 bp · TkA06G474310|TK1151|cDNA

CAGGGACCATTTTATAAGCAATTTAAAGGGGTTTATGGGGTTCTCAGTATCTCGCTACACAGTACACACTCGGTAGATCTTACCTGTAATAATCGGAGGAAAACGGCGATGGCGAAAAAACAAGGCCGGCGTGCACCAGTTAAGTCCGACCGCCGATCAAGCAGTTTCAGTGCCTTCGAATCGAGAGGATCCTTCAATTCGCCTAACTCACTTCATTACCTGCCTTACCCTAACAAACGCCTTACCTGCTCAACACTCTG...

CDS

Download CDS FASTA

486 bp · TkA06G474310|TK1151|CDS

ATGAAGGGAAATGCTCTGATTTTGCCTAGAGTTGTACTTGAAGCTATTCCTATGGACCTGCTAAAAAAGAAGAAACAGAGAGCTAAAGTAATCGACCTTATGATAACCGAATGCAAGGAGATGGGTTTTGATGGAATTGTTCTAGAATCTTGGTCAAGATGGGCTGCATACGGTGTCTTGCATGATCCACACATGCGCAAACTGGCACTGCAATTTGTTAAAAAGTTGGGACAAACCATGCATTCTGTGGGGAACTTGCA...

Protein

Download Protein FASTA

161 aa · TkA06G474310|TK1151|PROTEIN

MKGNALILPRVVLEAIPMDLLKKKKQRAKVIDLMITECKEMGFDGIVLESWSRWAAYGVLHDPHMRKLALQFVKKLGQTMHSVGNLQLIYVIGPPRTDKVQEYDFGPEDLLSLSDDVDGYSLMTYDFSNPQNPGPNAPLIWITSTLQLLLVALRICLKKYS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G474310`
TK1151 ID	TkA06G474310
OH-1004 ID	LXL04_022585
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 93.168 / OH-1004 34.722 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G474310`
Location	Chr06:117471442-117474487 (-)
Description	Similar to chid1: Chitinase domain-containing protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022585` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005975 carbohydrate metabolic process Biological Process GO:0045087 innate immune response Biological Process GO:0005576 extracellular region Cellular Component GO:0005615 extracellular space Cellular Component GO:0005764 lysosome Cellular Component GO:0005770 late endosome Cellular Component GO:0005802 trans-Golgi network Cellular Component GO:0012505 endomembrane system Cellular Component GO:0008061 chitin binding Molecular Function GO:0070492 oligosaccharide binding Molecular Function
KEGG gene cross-reference	mmu:68038 pon:100174208 rno:293628 xla:447354 xtr:493467 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.667

Rank 1 · TkA06G474310 · TK1151

Cytoplasm0.147

Rank 2 · TkA06G474310 · TK1151

Endoplasmic reticulum0.112

Rank 3 · TkA06G474310 · TK1151

Golgi apparatus0.059

Rank 4 · TkA06G474310 · TK1151

Nucleus0.049

Rank 5 · TkA06G474310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03644Glyco_hydro_8519-89 aa

PF00704Glyco_hydro_1820-139 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G474310	`PF03644`	Glyco_hydro_85	19	89	0.21	11.7
TkA06G474310	`PF00704`	Glyco_hydro_18	20	139	6.6e-09	36.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card