TkA06G473400 | RubberDandelionOmics

Gene overview

TkA06G473400

Reference: TK1151 Chr: Chr06 Coordinates: 117092646-117099746 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1404 bp · TkA06G473400|TK1151|cDNA

ATGGTGATGATCGAGATGCTGCCGGACTGCAACTCGGAGAAGGAGGAACCTGCCGGCGAAACTTTGACCGTCGCTGAAGGGAAGGCACCGGAGATGGCTGTGCGTCGGAGATCGGCAGCATGTGGGCAAAGGAACGGCGCCGATCTGGGTTTACTTATCAAGAATAACGGTAAAACGATGGATCATGATGTTGATTGGGGCCTTTATGCAATGGTTAAGGGAATTTGTCCTGCCATTGATGCCTCATTATCCTCTTTTGC...

CDS

Download CDS FASTA

1404 bp · TkA06G473400|TK1151|CDS

ATGGTGATGATCGAGATGCTGCCGGACTGCAACTCGGAGAAGGAGGAACCTGCCGGCGAAACTTTGACCGTCGCTGAAGGGAAGGCACCGGAGATGGCTGTGCGTCGGAGATCGGCAGCATGTGGGCAAAGGAACGGCGCCGATCTGGGTTTACTTATCAAGAATAACGGTAAAACGATGGATCATGATGTTGATTGGGGCCTTTATGCAATGGTTAAGGGAATTTGTCCTGCCATTGATGCCTCATTATCCTCTTTTGC...

Protein

Download Protein FASTA

467 aa · TkA06G473400|TK1151|PROTEIN

MVMIEMLPDCNSEKEEPAGETLTVAEGKAPEMAVRRRSAACGQRNGADLGLLIKNNGKTMDHDVDWGLYAMVKGICPAIDASLSSFAAAIPTAATPTIPTNNGQMSDEITDWNLATIVNDFFPTTIDFPSSSLSAIIPITTTTTFIPTITTTPSILENKSHVFDGINGWNLGVMLNGLYPTIDASSSFFDIVNTTTTTTTPLPTITTASIVHLNNSQIFDESIDWNLHARANSFYPTIATSSPSITTPYVPMDINNPQSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G473400`
TK1151 ID	TkA06G473400
OH-1004 ID	LXL04_022613
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.400
Protein coverage (%)	TK1151 61.456 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G473400

Location Chr06:117092646-117099746 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g01250`	Transcription factor involved in the expression of defense genes in innate immune response of plants.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a
`At5g52830`	Transcription factor.	No verified direct reference in this release
`At2g34830`	Transcription factor.	No verified direct reference in this release
`At1g30650`	Transcription factor.	No verified direct reference in this release
`At4g23550`	Transcription factor involved in the expression of defense genes in innate immune response of plants.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022613 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.936

Rank 1 · TkA06G473400 · TK1151

Cytoplasm0.103

Rank 2 · TkA06G473400 · TK1151

Cell membrane0.034

Rank 3 · TkA06G473400 · TK1151

Endoplasmic reticulum0.021

Rank 4 · TkA06G473400 · TK1151

Plastid0.014

Rank 5 · TkA06G473400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00299Squash75-79 aa

PF03106WRKY364-421 aa

PF00299Squash382-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G473400	`PF00299`	Squash	75	79	1.2	10.0
TkA06G473400	`PF03106`	WRKY	364	421	2.5e-20	73.1
TkA06G473400	`PF00299`	Squash	382	396	1.2	10.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04609`	Arabidopsis thaliana	sp\|O04609\|WRK22_ARATH WRKY transcription factor 22	40.500%	Swiss-Prot	Low
`Q9FLX8`	Arabidopsis thaliana	sp\|Q9FLX8\|WRK27_ARATH Probable WRKY transcription factor 27	45.800%	Swiss-Prot	Low
`O64747`	Arabidopsis thaliana	sp\|O64747\|WRK35_ARATH Probable WRKY transcription factor 35	46.700%	Swiss-Prot	Low
`Q9SA80`	Arabidopsis thaliana	sp\|Q9SA80\|WRK14_ARATH Probable WRKY transcription factor 14	46.200%	Swiss-Prot	Low
`Q9SUS1`	Arabidopsis thaliana	sp\|Q9SUS1\|WRK29_ARATH Probable WRKY transcription factor 29	39.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card