RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G460270
Reference: TK1151 Chr: Chr06 Coordinates: 113893436-113897650 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1929 bp · TkA06G460270|TK1151|cDNA

AACGAGTCTCCATTTCCCTATAAATTAACCATGGAATTCTTGTCATTCCTCGTATCTCTCAAACATTAATTATAAACCTTCTCTTCTATCATGAATATGAGAAAATATTACGATCTCCTCGCCCTTCGGAGATCTAAACGTCTCCTTCTCTCAAACAGAAATCCGGCACACCAAACCAGTCTCACTGAATCTCTCCGCCACCCTAAACCACCACCACCACCGCCGTCACCTCCCTCTTTCTATTCTCAAATATACAAAAA...

CDS

Download CDS FASTA

1656 bp · TkA06G460270|TK1151|CDS

ATGAATATGAGAAAATATTACGATCTCCTCGCCCTTCGGAGATCTAAACGTCTCCTTCTCTCAAACAGAAATCCGGCACACCAAACCAGTCTCACTGAATCTCTCCGCCACCCTAAACCACCACCACCACCGCCGTCACCTCCCTCTTTCTATTCTCAAATATACAAAAACACGTACCGTAATATTGTTTCCCATCATCGTCTACATCCAACTCGCTCAAATCTCACCACCAATCATCGTCATTTCCAGCTATCTAACCT...

Protein

Download Protein FASTA

551 aa · TkA06G460270|TK1151|PROTEIN

MNMRKYYDLLALRRSKRLLLSNRNPAHQTSLTESLRHPKPPPPPPSPPSFYSQIYKNTYRNIVSHHRLHPTRSNLTTNHRHFQLSNLHTSELATSLPDDHEDTSLLDYQVTVKGREVISADVTLGTHHWLPLSNLDLLLPPVAAGVFFCYKKKDNVNMSYETVVKTIKASLGGVLSTFYSLAGEIVENRQGEPEVVCNNRGVEFIEARADIKLKDLDFFHPDDSVKGKLVPKINGGVVAIQATELNCGSIIISGVFNHQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G460270
TK1151 IDTkA06G460270
OH-1004 IDLXL04_022711
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G460270
LocationChr06:113893436-113897650 (-)
DescriptionSimilar to HHT1: Omega-hydroxypalmitate O-feruloyl transferase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022711 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007623 circadian rhythm Biological Process
GO:0009699 phenylpropanoid biosynthetic process Biological Process
GO:0009723 response to ethylene Biological Process
GO:0009820 alkaloid metabolic process Biological Process
GO:0010345 suberin biosynthetic process Biological Process
GO:0010597 green leaf volatile biosynthetic process Biological Process
GO:0052325 cell wall pectin biosynthetic process Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups Molecular Function
GO:0034318 alcohol O-acyltransferase activity Molecular Function
GO:0047172 shikimate O-hydroxycinnamoyltransferase activity Molecular Function
GO:0050266 rosmarinate synthase activity Molecular Function
KEGG gene cross-reference
ag:ABG75942
ath:AT5G41040
dosa:Os04g0500700
nta:107796658
osa:4336306
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.695
Rank 1 · TkA06G460270 · TK1151
Mitochondrion0.197
Rank 2 · TkA06G460270 · TK1151
Cytoplasm0.112
Rank 3 · TkA06G460270 · TK1151
Nucleus0.069
Rank 4 · TkA06G460270 · TK1151
Peroxisome0.049
Rank 5 · TkA06G460270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02458Transferase109-536 aa
PF22664TRI-like_N147-192 aa
PF22664TRI-like_N235-263 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G460270PF02458Transferase1095367.7e-89299.0
TkA06G460270PF22664TRI-like_N1471920.1512.5
TkA06G460270PF22664TRI-like_N2352630.1512.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser