TkA06G440300 | RubberDandelionOmics

Gene overview

TkA06G440300

Reference: TK1151 Chr: Chr06 Coordinates: 108797708-108799021 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · TkA06G440300|TK1151|cDNA

ATGAGGCTTACTTTCAAATCAGTATTATCCTTCAAAGTAATGGCTGCACCACCGCAGGAACGGCCATGTCGGTGGTGCTGCTCTATTTCCGGTACGACGACTAGTAAGCAAAAAAAAGGTGCTCGTCCTCCCGCGAGACTTAGCAATCGATGGATGGAGTACCACGGCGGTAAGAATTGGGAAGGTTTATTAGACCCTCTTGACGACGGTTTGCGCGGCGAAATCATACGGTACGGAAGCTTCGTGGAGGCCGCTTACCA...

CDS

Download CDS FASTA

1254 bp · TkA06G440300|TK1151|CDS

ATGAGGCTTACTTTCAAATCAGTATTATCCTTCAAAGTAATGGCTGCACCACCGCAGGAACGGCCATGTCGGTGGTGCTGCTCTATTTCCGGTACGACGACTAGTAAGCAAAAAAAAGGTGCTCGTCCTCCCGCGAGACTTAGCAATCGATGGATGGAGTACCACGGCGGTAAGAATTGGGAAGGTTTATTAGACCCTCTTGACGACGGTTTGCGCGGCGAAATCATACGGTACGGAAGCTTCGTGGAGGCCGCTTACCA...

Protein

Download Protein FASTA

417 aa · TkA06G440300|TK1151|PROTEIN

MRLTFKSVLSFKVMAAPPQERPCRWCCSISGTTTSKQKKGARPPARLSNRWMEYHGGKNWEGLLDPLDDGLRGEIIRYGSFVEAAYQSFDFDPSSPTYASCRYTKSSILERSGVHRSGYRVTKHLHATSSFPLPRWIQRMPRWMQVQSSWVGYVAVCEDEKEISRLGRRDIVIALRGTATCLEWLENLRATLTHCNGDDSGEQKDEPMVEAGVLSLYASGTVMSPSLQQLLREEILRILRMYSGEPLSLTITGHSLGASL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G440300`
TK1151 ID	TkA06G440300
OH-1004 ID	LXL04_022817
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G440300

Location Chr06:108797708-108799021 (-)

Description Similar to DAD1: Phospholipase A(1) DAD1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44810`	Sn-1-specific phospholipase that releases free fatty acids from phospholipids.	No verified direct reference in this release
`At4g16820`	Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position.	No verified direct reference in this release
`At1g51440`	Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position.	No verified direct reference in this release
`At2g30550`	Acylhydrolase with broad specificity.	No verified direct reference in this release
`At2g31100`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022817 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009695 jasmonic acid biosynthetic process Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010152 pollen maturation Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0030308 negative regulation of cell growth Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G05800

ath:AT1G51440

ath:AT2G30550

ath:AT2G44810

ath:AT4G16820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.933

Rank 1 · TkA06G440300 · TK1151

Mitochondrion0.073

Rank 2 · TkA06G440300 · TK1151

Cytoplasm0.055

Rank 3 · TkA06G440300 · TK1151

Peroxisome0.033

Rank 4 · TkA06G440300 · TK1151

Nucleus0.031

Rank 5 · TkA06G440300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11187Mbeg1-like165-189 aa

PF26363Phospholipase-like168-193 aa

PF01764Lipase_3172-320 aa

PF00756Esterase212-311 aa

PF00975Thioesterase225-274 aa

PF07819PGAP1229-266 aa

PF11187Mbeg1-like237-286 aa

PF26363Phospholipase-like245-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G440300	`PF11187`	Mbeg1-like	165	189	0.17	11.9
TkA06G440300	`PF26363`	Phospholipase-like	168	193	0.056	13.4
TkA06G440300	`PF01764`	Lipase_3	172	320	3.9e-32	111.8
TkA06G440300	`PF00756`	Esterase	212	311	0.036	14.6
TkA06G440300	`PF00975`	Thioesterase	225	274	0.16	12.9
TkA06G440300	`PF07819`	PGAP1	229	266	0.098	13.1
TkA06G440300	`PF11187`	Mbeg1-like	237	286	0.17	11.9
TkA06G440300	`PF26363`	Phospholipase-like	245	265	0.056	13.4
TkA06G440300	`PF00975`	Thioesterase	295	311	0.16	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q948R1`	Arabidopsis thaliana	sp\|Q948R1\|PLA11_ARATH Phospholipase A(1) DAD1, chloroplastic	62.300%	Swiss-Prot	High
`O23522`	Arabidopsis thaliana	sp\|O23522\|PLA14_ARATH Phospholipase A1-Ibeta2, chloroplastic	45.500%	Swiss-Prot	Medium
`Q9C8J6`	Arabidopsis thaliana	sp\|Q9C8J6\|PLA17_ARATH Phospholipase A1-Igamma3, chloroplastic	40.200%	Swiss-Prot	Medium
`Q3EBR6`	Arabidopsis thaliana	sp\|Q3EBR6\|PLA16_ARATH Phospholipase A1-Igamma2, chloroplastic	37.200%	Swiss-Prot	Medium
`O82274`	Arabidopsis thaliana	sp\|O82274\|PLA19_ARATH Phospholipase A1-IIbeta	33.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card