TkA06G439410 | RubberDandelionOmics

Gene overview

TkA06G439410

Reference: TK1151 Chr: Chr06 Coordinates: 108609996-108612028 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1079 bp · TkA06G439410|TK1151|cDNA

AACGAACTCCCCAACAGATTCACTATAAACCTCCATCTCTTCTCGATCAGGTTTCTTCTTTAACATTCATTACTGAAATCTCACGTACAATGGATAGCTTCAAGAAATTCTTCATCAAGCCATGGAACTCCACCGCCATACTAAGTCAAGCTCCCATTTCACGTTTCGTCTGGATACACCTGATGATGTCATACTGCGTTTTAGGCTGCAGTTCAGTTGTTACGCTATTAGGAGCCTACAATCACAAGTTCTACGAAATT...

CDS

Download CDS FASTA

897 bp · TkA06G439410|TK1151|CDS

ATGGATAGCTTCAAGAAATTCTTCATCAAGCCATGGAACTCCACCGCCATACTAAGTCAAGCTCCCATTTCACGTTTCGTCTGGATACACCTGATGATGTCATACTGCGTTTTAGGCTGCAGTTCAGTTGTTACGCTATTAGGAGCCTACAATCACAAGTTCTACGAAATTGGAGGACGGACTACAGCCCTCGGATTCATCGGAAGTCTCTACTGGATGTCTAAGATCAAACCTTGGAACGCGGCACCCAGGGTATTCAT...

Protein

Download Protein FASTA

298 aa · TkA06G439410|TK1151|PROTEIN

MDSFKKFFIKPWNSTAILSQAPISRFVWIHLMMSYCVLGCSSVVTLLGAYNHKFYEIGGRTTALGFIGSLYWMSKIKPWNAAPRVFIFCLATHFFGLTIGPAINSIVEVDQGYIIKIIMGAVLFYTCQFSAIIHSVDRNIIYEIGEFSTPVFITAWMVISHIYPGFKSYALLLLFQPIPWYLLAFMLQHLRVTLHLRFNFPIHVAWITFLSFCFNYSFFNLMFVYIVVLGFLLHVRMHNQEVLYLAAHTSGENYYASSAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G439410`
TK1151 ID	TkA06G439410
OH-1004 ID	LXL04_022827
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	49.500
Protein coverage (%)	TK1151 100.000 / OH-1004 98.714 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G439410`
Location	Chr06:108609996-108612028 (-)
Description	Similar to BI-1: Bax inhibitor 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022827` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000038 very long-chain fatty acid metabolic process Biological Process GO:0006983 ER overload response Biological Process GO:0009414 response to water deprivation Biological Process GO:0033119 negative regulation of RNA splicing Biological Process GO:0034620 cellular response to unfolded protein Biological Process GO:0042761 very long-chain fatty acid biosynthetic process Biological Process GO:0043069 negative regulation of programmed cell death Biological Process GO:0005635 nuclear envelope Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference	ath:AT5G47120 dosa:Os02g0125300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.574

Rank 1 · TkA06G439410 · TK1151

Golgi apparatus0.183

Rank 2 · TkA06G439410 · TK1151

Nucleus0.158

Rank 3 · TkA06G439410 · TK1151

Cytoplasm0.132

Rank 4 · TkA06G439410 · TK1151

Cell membrane0.079

Rank 5 · TkA06G439410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01027Bax1-I30-139 aa

PF22420MglA_C113-154 aa

PF01027Bax1-I204-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G439410	`PF01027`	Bax1-I	30	139	0.0004	21.0
TkA06G439410	`PF22420`	MglA_C	113	154	0.33	11.6
TkA06G439410	`PF01027`	Bax1-I	204	268	0.0004	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card