TkA06G439330 | RubberDandelionOmics

Gene overview

TkA06G439330

Reference: TK1151 Chr: Chr06 Coordinates: 108589700-108590658 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

447 bp · TkA06G439330|TK1151|cDNA

ATGGTATCTGATGAAGAACTCGAATCTGGTGAAGAAACATACCTTCCTGCCTTAAATATCAGCTCAGAAAGATCTTGTATTATTTGTTTTTACCATTGTCAATTTTATAACAGTGGTTTTGATTTTATGAATGCTTCTCGTTGCTTTAATTGTGATGCGTATGATCATTCACTAAAAGAGTGTCGAAAGCCTTTTAATAAAGAAGTTGTCAGCAATGCCCTCAAATTGCATCAATTAAAAAGTAAAGGGTCTTCTGGCTC...

CDS

Download CDS FASTA

447 bp · TkA06G439330|TK1151|CDS

ATGGTATCTGATGAAGAACTCGAATCTGGTGAAGAAACATACCTTCCTGCCTTAAATATCAGCTCAGAAAGATCTTGTATTATTTGTTTTTACCATTGTCAATTTTATAACAGTGGTTTTGATTTTATGAATGCTTCTCGTTGCTTTAATTGTGATGCGTATGATCATTCACTAAAAGAGTGTCGAAAGCCTTTTAATAAAGAAGTTGTCAGCAATGCCCTCAAATTGCATCAATTAAAAAGTAAAGGGTCTTCTGGCTC...

Protein

Download Protein FASTA

148 aa · TkA06G439330|TK1151|PROTEIN

MVSDEELESGEETYLPALNISSERSCIICFYHCQFYNSGFDFMNASRCFNCDAYDHSLKECRKPFNKEVVSNALKLHQLKSKGSSGSCVLTRYYQNTPGGKFDGLKPGCVDVETRKLLGLGGTIATKCKHKDGFEKIYLEKDQTCDFA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G439330`
TK1151 ID	TkA06G439330
OH-1004 ID	LXL04_022823
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	77.400
Protein coverage (%)	TK1151 81.757 / OH-1004 42.566 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G439330`
Location	Chr06:108589700-108590658 (+)
Description	Similar to ZCCHC8: Zinc finger CCHC domain-containing protein 8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022823` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0006396 RNA processing Biological Process GO:0006401 RNA catabolic process Biological Process GO:0008380 RNA splicing Biological Process GO:0016076 snRNA catabolic process Biological Process GO:0031124 mRNA 3'-end processing Biological Process GO:0180034 co-transcriptional lncRNA 3' end processing, cleavage and polyadenylation pathway Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0016604 nuclear body Cellular Component GO:0031499 TRAMP complex Cellular Component GO:0062141 nuclear exosome targeting complex Cellular Component
KEGG gene cross-reference	hsa:55596 mmu:70650 pon:100173378 xla:446764 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.622

Rank 1 · TkA06G439330 · TK1151

Cytoplasm0.407

Rank 2 · TkA06G439330 · TK1151

Mitochondrion0.048

Rank 3 · TkA06G439330 · TK1151

Cell membrane0.038

Rank 4 · TkA06G439330 · TK1151

Endoplasmic reticulum0.032

Rank 5 · TkA06G439330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00098zf-CCHC31-34 aa

PF30379SLU7_N46-61 aa

PF00098zf-CCHC47-63 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G439330	`PF00098`	zf-CCHC	31	34	0.084	13.7
TkA06G439330	`PF30379`	SLU7_N	46	61	0.093	12.9
TkA06G439330	`PF00098`	zf-CCHC	47	63	0.084	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card