TkA06G432140 | RubberDandelionOmics

Gene overview

TkA06G432140

Reference: TK1151 Chr: Chr06 Coordinates: 106938085-106939413 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1245 bp · TkA06G432140|TK1151|cDNA

ATGAGCCACCCACATGTCCTCCTTGTTGCTCGACACGACTACGGCCATCTCAACCCAATTATTGAGCTCGCCAAAAACTTCAAACACGCCGGTGCACGACTCACCGTCGCTACCACCGCCAACGGCTTTCACAAGCTCAAATCTTTACCCTCTCTTAACGGAATATCTATTGCTTTCTTCTCCGACGGCCATGACGATGATGTCAACGCAGCCAAGATCCCCGGCTACTTCCATGACCTAAAGCGTGTGGGTTCCAAGAG...

CDS

Download CDS FASTA

1245 bp · TkA06G432140|TK1151|CDS

ATGAGCCACCCACATGTCCTCCTTGTTGCTCGACACGACTACGGCCATCTCAACCCAATTATTGAGCTCGCCAAAAACTTCAAACACGCCGGTGCACGACTCACCGTCGCTACCACCGCCAACGGCTTTCACAAGCTCAAATCTTTACCCTCTCTTAACGGAATATCTATTGCTTTCTTCTCCGACGGCCATGACGATGATGTCAACGCAGCCAAGATCCCCGGCTACTTCCATGACCTAAAGCGTGTGGGTTCCAAGAG...

Protein

Download Protein FASTA

414 aa · TkA06G432140|TK1151|PROTEIN

MSHPHVLLVARHDYGHLNPIIELAKNFKHAGARLTVATTANGFHKLKSLPSLNGISIAFFSDGHDDDVNAAKIPGYFHDLKRVGSKSLAGLIQNLLESGNQVNLLVYTLFLPWAAVVARELNLPSAILLIQSATCFSIYYRFCNSHDGIVVVNKDIGTSLSLQLPGLPLLKWGDFPTFALPTSPYFTDLVTVCQEHLKFLEEEPNPRVLLNTIDGLEPDSVKSIGNAIVVGPLVPSSSSGIHHGSYFQWLDSKPKNSVVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G432140`
TK1151 ID	TkA06G432140
OH-1004 ID	LXL04_014526
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G432140

Location Chr06:106938085-106939413 (+)

Description Similar to UGT75C1: UDP-glycosyltransferase 75C1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14090`	Catalyzes the glycosylation of anthocyanins from UDP-glucose.	Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor.2005 · DOI: 10.1111/j.1365-313x.2005.02371.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014526 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009698 phenylpropanoid metabolic process Biological Process

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009835 fruit ripening Biological Process

GO:0009845 seed germination Biological Process

GO:0080148 negative regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:BAK55736

ath:AT4G14090

mdm:103443397

sly:101250450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.819

Rank 1 · TkA06G432140 · TK1151

Nucleus0.230

Rank 2 · TkA06G432140 · TK1151

Endoplasmic reticulum0.073

Rank 3 · TkA06G432140 · TK1151

Peroxisome0.047

Rank 4 · TkA06G432140 · TK1151

Cell membrane0.043

Rank 5 · TkA06G432140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06722EryCIII-like_C218-249 aa

PF00201UDPGT250-267 aa

PF00201UDPGT282-373 aa

PF06722EryCIII-like_C289-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G432140	`PF06722`	EryCIII-like_C	218	249	3.4e-05	24.6
TkA06G432140	`PF00201`	UDPGT	250	267	5.3e-17	62.5
TkA06G432140	`PF00201`	UDPGT	282	373	5.3e-17	62.5
TkA06G432140	`PF06722`	EryCIII-like_C	289	374	3.4e-05	24.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WW21`	Arabidopsis thaliana	sp\|Q0WW21\|U75C1_ARATH UDP-glycosyltransferase 75C1	40.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card