TkA06G425700 | RubberDandelionOmics

Gene overview

TkA06G425700

Reference: TK1151 Chr: Chr06 Coordinates: 105298183-105304318 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3021 bp · TkA06G425700|TK1151|cDNA

ATGGTTCTATCACTCGAGAAAGGGGGCAACCAAGGGAAGGGAACTTACCGGAAACAAGGTGCTGGTCGCCGGAAGGACAGCAAGGGCGATCGGAAAACTGCCGGAACAAAAGATCGCCGGGAAAAACGAACAGAGCAAGGTGCTGTAGTCGCCGCTGTGTTTGAACAAGAGAGGGAAGCACGGAAGTTTCCTCGCCGGAAGAAGCTGCGAAGTGGTCGGAGAAGGAGTAAAGTTCTTGCATACAGAAGAGATGAAGAAGA...

CDS

Download CDS FASTA

3021 bp · TkA06G425700|TK1151|CDS

ATGGTTCTATCACTCGAGAAAGGGGGCAACCAAGGGAAGGGAACTTACCGGAAACAAGGTGCTGGTCGCCGGAAGGACAGCAAGGGCGATCGGAAAACTGCCGGAACAAAAGATCGCCGGGAAAAACGAACAGAGCAAGGTGCTGTAGTCGCCGCTGTGTTTGAACAAGAGAGGGAAGCACGGAAGTTTCCTCGCCGGAAGAAGCTGCGAAGTGGTCGGAGAAGGAGTAAAGTTCTTGCATACAGAAGAGATGAAGAAGA...

Protein

Download Protein FASTA

1006 aa · TkA06G425700|TK1151|PROTEIN

MVLSLEKGGNQGKGTYRKQGAGRRKDSKGDRKTAGTKDRREKRTEQGAVVAAVFEQEREARKFPRRKKLRSGRRRSKVLAYRRDEEEIDRKMYRVVSPYIASTNRQFNLLPTLSTSTPLSEIISNSSFQKLSSGKHNFKRKKTDLADIPVFDLSSDDEEIDEPIVYDRNLPISKDYLDHGDQIIECMSMLDSTNELVKCYRMARDCLNENPDVDLKLRLISRRQSDGRTYNLPTSSEVAALIVGDIGESLDNRDIVVKTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G425700`
TK1151 ID	TkA06G425700
OH-1004 ID	LXL04_006090
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	76.900
Protein coverage (%)	TK1151 86.978 / OH-1004 59.657 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G425700`
Location	Chr06:105298183-105304318 (-)
Description	Similar to RPA1A: Replication protein A 70 kDa DNA-binding subunit A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006090` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.921

Rank 1 · TkA06G425700 · TK1151

Cytoplasm0.146

Rank 2 · TkA06G425700 · TK1151

Mitochondrion0.035

Rank 3 · TkA06G425700 · TK1151

Cell membrane0.014

Rank 4 · TkA06G425700 · TK1151

Extracellular0.009

Rank 5 · TkA06G425700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05840Phage_GPA62-101 aa

PF14214Helitron_like_N314-494 aa

PF05840Phage_GPA400-501 aa

PF23343REP_ORF2-G2P420-508 aa

PF05970PIF1762-853 aa

PF21530Pif1_2B_dom959-1003 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G425700	`PF05840`	Phage_GPA	62	101	0.081	12.7
TkA06G425700	`PF14214`	Helitron_like_N	314	494	1.5e-56	192.4
TkA06G425700	`PF05840`	Phage_GPA	400	501	0.081	12.7
TkA06G425700	`PF23343`	REP_ORF2-G2P	420	508	0.00011	23.1
TkA06G425700	`PF05970`	PIF1	762	853	1.2e-27	97.7
TkA06G425700	`PF21530`	Pif1_2B_dom	959	1003	5e-19	68.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card