TkA06G417610 | RubberDandelionOmics

Gene overview

TkA06G417610

Reference: TK1151 Chr: Chr06 Coordinates: 103354266-103355141 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

876 bp · TkA06G417610|TK1151|cDNA

ATGGCTCGTAACGAAGAGAAAGCTCAATCGATGCTCAACAGGTTCATAACAATGAAAGCCGAGGAGAAAAAGAAGCCTAAAGACCGCCGCCCGTTCTTAGCCTCGGAATGCCGGGACCTTGCCGACGCCGACAAGTGGCGCCAGCAAATCATGCGTGAAATCGGCCGTAAAGTCGCTGAAATCCAGAACGAGGGTTTGGGCGAACACCGTCTCCGCGATCTCAATGACGAGATCAACAAACTAATTCGCGAGAAAGGACA...

CDS

Download CDS FASTA

876 bp · TkA06G417610|TK1151|CDS

ATGGCTCGTAACGAAGAGAAAGCTCAATCGATGCTCAACAGGTTCATAACAATGAAAGCCGAGGAGAAAAAGAAGCCTAAAGACCGCCGCCCGTTCTTAGCCTCGGAATGCCGGGACCTTGCCGACGCCGACAAGTGGCGCCAGCAAATCATGCGTGAAATCGGCCGTAAAGTCGCTGAAATCCAGAACGAGGGTTTGGGCGAACACCGTCTCCGCGATCTCAATGACGAGATCAACAAACTAATTCGCGAGAAAGGACA...

Protein

Download Protein FASTA

291 aa · TkA06G417610|TK1151|PROTEIN

MARNEEKAQSMLNRFITMKAEEKKKPKDRRPFLASECRDLADADKWRQQIMREIGRKVAEIQNEGLGEHRLRDLNDEINKLIREKGHWERRIVELGGHNYSRYSAKMTDLEGNIVDVPNPSGRGPGYRYFGAAKKLPGVKELFEKPPELRKRRSRYDIYKRIDASYYGYRDDEDGVLEKVEGPAEERMRAEAVAEWMRMEEIKKEARRAVKSGEVADVGGAARTILYEEEEDVVEEERMKERELEEKEKEKEFVVHVPLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G417610`
TK1151 ID	TkA06G417610
OH-1004 ID	LXL04_023007
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 97.595 / OH-1004 91.318 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G417610`
Location	Chr06:103354266-103355141 (+)
Description	Similar to Isy1: Pre-mRNA-splicing factor ISY1 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023007` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000350 generation of catalytic spliceosome for second transesterification step Biological Process GO:0000389 mRNA 3'-splice site recognition Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:2000634 regulation of primary miRNA processing Biological Process GO:0000974 Prp19 complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0016607 nuclear speck Cellular Component GO:0071006 U2-type catalytic step 1 spliceosome Cellular Component GO:0071013 catalytic step 2 spliceosome Cellular Component GO:0071014 post-mRNA release spliceosomal complex Cellular Component
KEGG gene cross-reference	cel:CELE_F53B7.3 ddi:DDB_G0285521 hsa:100534599 hsa:57461 mmu:57905 rno:362394 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.952

Rank 1 · TkA06G417610 · TK1151

Cytoplasm0.114

Rank 2 · TkA06G417610 · TK1151

Mitochondrion0.017

Rank 3 · TkA06G417610 · TK1151

Cell membrane0.015

Rank 4 · TkA06G417610 · TK1151

Endoplasmic reticulum0.007

Rank 5 · TkA06G417610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06246Isy11-280 aa

PF00992Troponin4-106 aa

PF11208DUF29926-29 aa

PF04055Radical_SAM73-91 aa

PF04055Radical_SAM193-268 aa

PF11208DUF2992197-256 aa

PF00992Troponin227-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G417610	`PF06246`	Isy1	1	280	2.5e-93	313.1
TkA06G417610	`PF00992`	Troponin	4	106	0.0071	17.3
TkA06G417610	`PF11208`	DUF2992	6	29	0.042	14.8
TkA06G417610	`PF04055`	Radical_SAM	73	91	0.77	10.6
TkA06G417610	`PF04055`	Radical_SAM	193	268	0.77	10.6
TkA06G417610	`PF11208`	DUF2992	197	256	0.042	14.8
TkA06G417610	`PF00992`	Troponin	227	255	0.0071	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card