RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G393100
Reference: TK1151 Chr: Chr06 Coordinates: 97431762-97448864 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5611 bp · TkA06G393100|TK1151|cDNA

AGATAATAAAATTCCTGATGGACCCAAATTCAACCTCATCACCATCGGTCAAGTTTTCCTACAATCACAAACCTTGCGGAGGTTTTGAAGCAAGTCTCCTGCAGTTATTCAAGGGCATGGAGTTATAGATTAGAACTACAGAAGAACAATTCGATTCCCAGGAAACACAATTTGGCATCTCAAATTCGTCTGAATCCTCCTATGCTTCAAATCGTCACCAAGCAAATATTGCAAGTCACACAAATACTCAAAACTCACGG...

CDS

Download CDS FASTA

3840 bp · TkA06G393100|TK1151|CDS

ATGGCTGAAATTGTTGTTTCTGCTTTCTTCACGGTGTTCTTTGAGAAACTAGCATCTAAAGCTTTGAAGAAGCTTGCTCGCTCCAAGGGAATTGATTCCGAGCTAAAGAAACTGAAGAGGTCGTTAATCCAGATCAAAGCACTTCTTAACGATGCTGCTCAAAAGGAAATAAGTGATGAAGCTGTCAAAGAATGGCTGAATGGTCTCCAACACCTTGCATACGACATAGACGATGTACTTGACGATTTGGCAACTGAAGC...

Protein

Download Protein FASTA

1279 aa · TkA06G393100|TK1151|PROTEIN

MAEIVVSAFFTVFFEKLASKALKKLARSKGIDSELKKLKRSLIQIKALLNDAAQKEISDEAVKEWLNGLQHLAYDIDDVLDDLATEAMHRELTEESEGSTSMVRKLIPTCCTNFSPSSRMQGKLDDIATKLQELVEEKNNLGLSVKGESPKLMNNRRLQTCLIDASSIVGRESDKDAMLQNLLGDEQSDKHYTIVPIVGMGGLGKTTLARLLYEEMQGKDHFELMAWVCVSDEFDILNISKIIFQAIGGGNEEFKDLNML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G393100
TK1151 IDTkA06G393100
OH-1004 IDLXL04_023144
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)87.400
Protein coverage (%)TK1151 99.375 / OH-1004 85.637
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G393100
LocationChr06:97431762-97448864 (-)
DescriptionSimilar to RPPL1: Putative disease resistance RPP13-like protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g27040 Together with RDM3, required for transcriptional gene silencing (TGS) by DNA methylation and repressive histone modifications (H3K9me2) of several chromatin loci.
ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation.2003 · DOI: 10.1126/science.1079695
Role of Arabidopsis ARGONAUTE4 in RNA-directed DNA methylation triggered by inverted repeats.2004 · DOI: 10.1016/j.cub.2004.06.055
The Arabidopsis chromatin-modifying nuclear siRNA pathway involves a nucleolar RNA processing center.2006 · DOI: 10.1016/j.cell.2006.05.031
An ARGONAUTE4-containing nuclear processing center colocalized with Cajal bodies in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cell.2006.05.032
Distinct catalytic and non-catalytic roles of ARGONAUTE4 in RNA-directed DNA methylation.2006 · DOI: 10.1038/nature05198
Reiterated WG/GW motifs form functionally and evolutionarily conserved ARGONAUTE-binding platforms in RNAi-related components.2007 · DOI: 10.1101/gad.451207
ARGONAUTE4 is required for resistance to Pseudomonas syringae in Arabidopsis.2007 · DOI: 10.1105/tpc.107.054494
Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide.2008 · DOI: 10.1016/j.cell.2008.02.034
Viral genome methylation as an epigenetic defense against geminiviruses.2008 · DOI: 10.1128/jvi.00719-08
RNA polymerase V transcription guides ARGONAUTE4 to chromatin.2009 · DOI: 10.1038/ng.365
The Arabidopsis RNA-directed DNA methylation argonautes functionally diverge based on their expression and interaction with target loci.2010 · DOI: 10.1105/tpc.109.072199
Independent chromatin binding of ARGONAUTE4 and SPT5L/KTF1 mediates transcriptional gene silencing.2011 · DOI: 10.1371/journal.pgen.1002120
At5g21150 Involved in RNA-mediated post-transcriptional gene silencing (PTGS).
The Arabidopsis RNA-directed DNA methylation argonautes functionally diverge based on their expression and interaction with target loci.2010 · DOI: 10.1105/tpc.109.072199
Control of female gamete formation by a small RNA pathway in Arabidopsis.2010 · DOI: 10.1038/nature08828
ARGONAUTE9-dependent silencing of transposable elements in pericentromeric regions of Arabidopsis.2010 · DOI: 10.1038/nature08828
At3g14470 Potential disease resistance protein. No verified direct reference in this release
At3g14460 Potential disease resistance protein. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0275600 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Os04g0151800 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Os07g0265600 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_023144 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0042742 defense response to bacterium Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0051607 defense response to virus Biological Process
GO:0098542 defense response to other organism Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0004016 adenylate cyclase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0043531 ADP binding Molecular Function
KEGG gene cross-reference
ath:AT3G14460
ath:AT3G14470
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.489
Rank 1 · TkA06G393100 · TK1151
Cytoplasm0.329
Rank 2 · TkA06G393100 · TK1151
Nucleus0.227
Rank 3 · TkA06G393100 · TK1151
Endoplasmic reticulum0.070
Rank 4 · TkA06G393100 · TK1151
Plastid0.055
Rank 5 · TkA06G393100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052Rx_N12-95 aa
PF20994CENPU28-133 aa
PF18052Rx_N128-183 aa
PF13191AAA_16168-237 aa
PF00931NB-ARC172-342 aa
PF13401AAA_22192-280 aa
PF20720nSTAND3192-240 aa
PF23559WHD_DRP428-496 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G393100PF18052Rx_N12951e-2177.5
TkA06G393100PF20994CENPU281330.04314.2
TkA06G393100PF18052Rx_N1281831e-2177.5
TkA06G393100PF13191AAA_161682370.007317.6
TkA06G393100PF00931NB-ARC1723421.5e-31110.0
TkA06G393100PF13401AAA_221922800.007217.4
TkA06G393100PF20720nSTAND31922400.02614.9
TkA06G393100PF23559WHD_DRP4284962.7e-2485.7
TkA06G393100PF20994CENPU4915140.04314.2
TkA06G393100PF25013LRR_Zer-15615944.7e-0627.5
TkA06G393100PF25019LRR_R13L1-DRL215696361.8e-45154.7
TkA06G393100PF23598LRR_145758515.9e-30104.9
TkA06G393100PF23622LRR_At1g61320_AtMIF15816800.006716.6
TkA06G393100PF23286LRR_135816660.01615.7
TkA06G393100PF13855LRR_85826384.9e-0626.9
TkA06G393100PF23211LRR_LRWD15826334.47.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9ZVD5Arabidopsis thalianasp|Q9ZVD5|AGO4_ARATH Protein argonaute 473.700%Swiss-ProtHigh
Q84VQ0Arabidopsis thalianasp|Q84VQ0|AGO9_ARATH Protein argonaute 969.100%Swiss-ProtHigh
Q9LRR4Arabidopsis thalianasp|Q9LRR4|R13L1_ARATH Putative disease resistance RPP13-like protein 134.900%Swiss-ProtMedium
Q9LRR5Arabidopsis thalianasp|Q9LRR5|DRL21_ARATH Putative disease resistance protein At3g1446034.700%Swiss-ProtMedium
Q9SDG8Oryza sativa subsp. japonicasp|Q9SDG8|AGO4A_ORYSJ Protein argonaute 4A73.000%Swiss-ProtHigh
Q0JF58Oryza sativa subsp. japonicasp|Q0JF58|AGO4B_ORYSJ Protein argonaute 4B71.200%Swiss-ProtHigh
Q6YSJ5Oryza sativa subsp. japonicasp|Q6YSJ5|AGO16_ORYSJ Protein argonaute 1663.800%Swiss-ProtHigh

JBrowse

View in Genome Browser