TkA06G390000 | RubberDandelionOmics

Gene overview

TkA06G390000

Reference: TK1151 Chr: Chr06 Coordinates: 96616081-96618604 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1645 bp · TkA06G390000|TK1151|cDNA

CCTAAATCCCACGATCTCCTTCGGTTCTTCTCATTCTTCGCATTTGCAAGATCCAACTGCATGATCATGGTCGAACTTCCCCTGAAATTCAGTCTATTATCCCATATAAAAGGAAGGAATCGTCTCCCTCTAGACAGAAATCGGAATCGTCTCCCTCTACCCAGAAATCGACGCCGAGTGGTATGAAGTTCAAGACAGAAATCAGTGCCGATTGTGAAATTGAGAAGGATTTACCCACTGGATTGAAGGAATCGTCTCCC...

CDS

Download CDS FASTA

672 bp · TkA06G390000|TK1151|CDS

ATGAAGTTCAAGACAGAAATCAGTGCCGATTGTGAAATTGAGAAGGATTTACCCACTGGATTGAAGGAATCGTCTCCCTCTAGACAGAAATCGGAATCGTCTCCCTCTAGCCAGAAATCGACGCCGAGTGGTATGAAGTTCAAGACAGAAATCAGTGCCGATTGTGAAATTGAGAAGGTAATATGGGTTAAATCTGAAGGCATTGGATGCAGAGCAACTAAGAGAACACGGCCACAAAATGGTACTACAAGAATATCGAG...

Protein

Download Protein FASTA

223 aa · TkA06G390000|TK1151|PROTEIN

MKFKTEISADCEIEKDLPTGLKESSPSRQKSESSPSSQKSTPSGMKFKTEISADCEIEKVIWVKSEGIGCRATKRTRPQNGTTRISRLSLFSQVEPGYLQKLLLDPAPVHTESLQAVLQDVETKILQGVTHWQSPDYFAYFPSNSSVASFLGEMLSAGINMVGFSWITSPVATELEMIFLHRLANLLKLPHDFLSTGNKTNLYLFFHFLNVARITDPDRGGRS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G390000`
TK1151 ID	TkA06G390000
OH-1004 ID	LXL04_007643
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	51.300
Protein coverage (%)	TK1151 50.673 / OH-1004 68.072 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G390000

Location Chr06:96616081-96618604 (-)

Description Similar to TYDC2: Tyrosine/DOPA decarboxylase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20340`	Bifunctional enzyme that catalyzes the decarboxylation of L- phenylalanine to 2-phenylethylamine, which is then oxidized to form 2- phenylacetaldehyde, a constituent of floral scent.	Role of aromatic aldehyde synthase in wounding/herbivory response and flower scent production in different Arabidopsis ecotypes.2011 · DOI: 10.1111/j.1365-313x.2011.04515.x
`At4g28680`	Converts tyrosine into tyramine, a precursor of isoquinoline alkaloids and various amides.	Gene expression and characterization of a stress-induced tyrosine decarboxylase from Arabidopsis thaliana.2009 · DOI: 10.1016/j.febslet.2009.05.017 Role of aromatic aldehyde synthase in wounding/herbivory response and flower scent production in different Arabidopsis ecotypes.2011 · DOI: 10.1111/j.1365-313x.2011.04515.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0437500`	Involved in serotonin biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007643 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006520 amino acid metabolic process Biological Process

GO:0009821 alkaloid biosynthetic process Biological Process

GO:0019752 carboxylic acid metabolic process Biological Process

GO:0042444 phenylethylamine biosynthetic process Biological Process

GO:1901695 tyramine biosynthetic process Biological Process

GO:1903184 L-dopa metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0004837 tyrosine decarboxylase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0036467 5-hydroxy-L-tryptophan decarboxylase activity Molecular Function

GO:0036468 L-dopa decarboxylase activity Molecular Function

GO:0036469 L-tryptophan decarboxylase activity Molecular Function

KEGG gene cross-reference

ag:AAA33860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.597

Rank 1 · TkA06G390000 · TK1151

Nucleus0.305

Rank 2 · TkA06G390000 · TK1151

Mitochondrion0.133

Rank 3 · TkA06G390000 · TK1151

Endoplasmic reticulum0.082

Rank 4 · TkA06G390000 · TK1151

Peroxisome0.073

Rank 5 · TkA06G390000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00282Pyridoxal_deC96-197 aa

PF18580HTH_SUN2114-134 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G390000	`PF00282`	Pyridoxal_deC	96	197	1.1e-25	90.9
TkA06G390000	`PF18580`	HTH_SUN2	114	134	0.2	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RY79`	Arabidopsis thaliana	sp\|Q8RY79\|PAAS_ARATH Phenylacetaldehyde synthase	66.700%	Swiss-Prot	Medium
`Q9M0G4`	Arabidopsis thaliana	sp\|Q9M0G4\|TYDC2_ARATH Tyrosine decarboxylase 2	62.400%	Swiss-Prot	Low
`Q7XHL3`	Oryza sativa subsp. japonica	sp\|Q7XHL3\|TDC2_ORYSJ Tryptophan decarboxylase 2	59.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card