TkA06G377160 | RubberDandelionOmics

Gene overview

TkA06G377160

Reference: TK1151 Chr: Chr06 Coordinates: 93419026-93423355 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1744 bp · TkA06G377160|TK1151|cDNA

GACCGACTTGAATAAAGGCCGAAGAAGACGGAGTGACAACATACCATGGTTTATTTCCAAAAGGAACCATGAATAATACCAACATCGATTTCAAAAATCAAGATCCGAAGAAAGGTACCGCCCCCATTGATAACAATCTCACAACCCTTGATTCGAGGTTCAATCAAACTCTCCGCAATGTGCAAGGGTTCATAAAGGGTCGCAGCTTCCCTGGCAAAATCTTGATAACAAGATCAGATCCAGGTGAAATTACAATTATA...

CDS

Download CDS FASTA

1371 bp · TkA06G377160|TK1151|CDS

ATGAATAATACCAACATCGATTTCAAAAATCAAGATCCGAAGAAAGGTACCGCCCCCATTGATAACAATCTCACAACCCTTGATTCGAGGTTCAATCAAACTCTCCGCAATGTGCAAGGGTTCATAAAGGGTCGCAGCTTCCCTGGCAAAATCTTGATAACAAGATCAGATCCAGGTGAAATTACAATTATACCCTCTCCCCGTGTTGATACCAGTCCCTCTGAGAATATTACAGGCTCAAGTAAACACATTGATGATAG...

Protein

Download Protein FASTA

456 aa · TkA06G377160|TK1151|PROTEIN

MNNTNIDFKNQDPKKGTAPIDNNLTTLDSRFNQTLRNVQGFIKGRSFPGKILITRSDPGEITIIPSPRVDTSPSENITGSSKHIDDRNEDQVHRSKSDASTTATDLNSSTTNSESSSKDTPRVTMSTRATDTARIMKFTKVLGGVNVILDKLRELAWSGVPHYLRPNVWRLLLGYAPPNSDRRDGILTRKRIEYFDCVSQYYDVSDNERTDEEINMLRQIAVDCPRTVPDVTFFQQEEVQKSLERILYTWAIRHPASGYV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G377160`
TK1151 ID	TkA06G377160
OH-1004 ID	LXL04_014692
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	76.000
Protein coverage (%)	TK1151 100.000 / OH-1004 96.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G377160`
Location	Chr06:93419026-93423355 (-)
Description	Similar to TBC1D22B: TBC1 domain family member 22B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014692` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016192 vesicle-mediated transport Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005795 Golgi stack Cellular Component GO:0005829 cytosol Cellular Component GO:0005096 GTPase activator activity Molecular Function GO:0042803 protein homodimerization activity Molecular Function GO:0071889 14-3-3 protein binding Molecular Function
KEGG gene cross-reference	hsa:25771 hsa:55633 spo:2540892 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.663

Rank 1 · TkA06G377160 · TK1151

Nucleus0.219

Rank 2 · TkA06G377160 · TK1151

Golgi apparatus0.175

Rank 3 · TkA06G377160 · TK1151

Lysosome / Vacuole0.112

Rank 4 · TkA06G377160 · TK1151

Cell membrane0.093

Rank 5 · TkA06G377160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14963Get2_like91-119 aa

PF00566RabGAP-TBC92-113 aa

PF00566RabGAP-TBC164-407 aa

PF23436RabGap-TBC_2241-273 aa

PF23436RabGap-TBC_2300-422 aa

PF14963Get2_like364-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G377160	`PF14963`	Get2_like	91	119	0.25	12.1
TkA06G377160	`PF00566`	RabGAP-TBC	92	113	1.1e-48	166.5
TkA06G377160	`PF00566`	RabGAP-TBC	164	407	1.1e-48	166.5
TkA06G377160	`PF23436`	RabGap-TBC_2	241	273	4.1e-09	37.1
TkA06G377160	`PF23436`	RabGap-TBC_2	300	422	4.1e-09	37.1
TkA06G377160	`PF14963`	Get2_like	364	402	0.25	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card