TkA06G328890 | RubberDandelionOmics

Gene overview

TkA06G328890

Reference: TK1151 Chr: Chr06 Coordinates: 82101657-82103536 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

801 bp · TkA06G328890|TK1151|cDNA

TATTTAGCGGAAAAATCAAAATATAACGTGAAAAAATTAGCTACCAAAATTAAAACAAGGCTGTGGAGAACAAACCACTAGAACTACACCCCCACAAAGGCCAAATCAAAGCAAAAACAAATGGCTAGCTTTCTTCTGAACACCTTGAGGAACCCCAGTGTCATTGCTTCCTCTTCCTCCAATGGGTCTTTTCCAACTTCCAGTAATCAAGTATCTCAATCAGGGAAAGGAGGTCCAGTCATTGTTGAGCTTCCCCTTAA...

CDS

Download CDS FASTA

381 bp · TkA06G328890|TK1151|CDS

ATGGCTAGCTTTCTTCTGAACACCTTGAGGAACCCCAGTGTCATTGCTTCCTCTTCCTCCAATGGGTCTTTTCCAACTTCCAGTAATCAAGTATCTCAATCAGGGAAAGGAGGTCCAGTCATTGTTGAGCTTCCCCTTAACCAAATTCGGAGACCTTTGATGCGCACAAGAGCTAATGATCCACATAAGGTGCAAGAACTCATGGATAGTATTGCCCAAATTGGTCTTCAAGTACCCATCGATGTGCTTGAAGTTGAAGG...

Protein

Download Protein FASTA

126 aa · TkA06G328890|TK1151|PROTEIN

MASFLLNTLRNPSVIASSSSNGSFPTSSNQVSQSGKGGPVIVELPLNQIRRPLMRTRANDPHKVQELMDSIAQIGLQVPIDVLEVEGAYYGFSGCHRYEAHQRLGLPTIRCKIRRGTKETLRHHLR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G328890`
TK1151 ID	TkA06G328890
OH-1004 ID	LXL04_023397
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G328890

Location Chr06:82101657-82103536 (+)

Description Similar to SRX: Sulfiredoxin, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31170`	Contributes to oxidative stress resistance by reducing cysteine-sulfinic acid formed under exposure to oxidants in a peroxiredoxin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023397 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0043327 chemotaxis to cAMP Biological Process

GO:0098869 cellular oxidant detoxification Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016667 oxidoreductase activity, acting on a sulfur group of donors Molecular Function

KEGG gene cross-reference

ath:AT1G31170

ddi:DDB_G0282925

dme:Dmel_CG6762

hsa:140809

mmu:76650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.500

Rank 1 · TkA06G328890 · TK1151

Cytoplasm0.346

Rank 2 · TkA06G328890 · TK1151

Mitochondrion0.135

Rank 3 · TkA06G328890 · TK1151

Plastid0.104

Rank 4 · TkA06G328890 · TK1151

Cell membrane0.041

Rank 5 · TkA06G328890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02195ParB_N40-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G328890	`PF02195`	ParB_N	40	124	5.7e-17	62.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GY89`	Arabidopsis thaliana	sp\|Q8GY89\|SRX_ARATH Sulfiredoxin, chloroplastic/mitochondrial	75.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card