TkA06G190550 | RubberDandelionOmics

Gene overview

TkA06G190550

Reference: TK1151 Chr: Chr06 Coordinates: 49714861-49715187 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

327 bp · TkA06G190550|TK1151|cDNA

ATGGTGGAAGATGCCATAGGGGGGATAACTACGGAGCAAGCCAAACAATACCTACGAAACCATCGCACCTCGGTAGCCCTGGAAGATGTCCGAGTAATCCAAAACGAGATGATCAGGAAGCTAGACCAGATGATGGGAAAATTAGACAGAGGAAAGGGCATCGAGAGCACCGACTCAAGTACAAAACCCCTAGCTCGAACGTCGTTATCAGAACAGGCGGATGCGGCAAAAATGTTGAATATTGTTATAAAAAGATTGTA...

CDS

Download CDS FASTA

327 bp · TkA06G190550|TK1151|CDS

ATGGTGGAAGATGCCATAGGGGGGATAACTACGGAGCAAGCCAAACAATACCTACGAAACCATCGCACCTCGGTAGCCCTGGAAGATGTCCGAGTAATCCAAAACGAGATGATCAGGAAGCTAGACCAGATGATGGGAAAATTAGACAGAGGAAAGGGCATCGAGAGCACCGACTCAAGTACAAAACCCCTAGCTCGAACGTCGTTATCAGAACAGGCGGATGCGGCAAAAATGTTGAATATTGTTATAAAAAGATTGTA...

Protein

Download Protein FASTA

108 aa · TkA06G190550|TK1151|PROTEIN

MVEDAIGGITTEQAKQYLRNHRTSVALEDVRVIQNEMIRKLDQMMGKLDRGKGIESTDSSTKPLARTSLSEQADAAKMLNIVIKRLYMFYVFIVEEYDKIFCWEVRKC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G190550`
TK1151 ID	TkA06G190550
OH-1004 ID	LXL04_023991
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 19.014 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G190550`
Location	Chr06:49714861-49715187 (+)
Description	Similar to CYP38: Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023991` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0010102 lateral root morphogenesis Biological Process GO:0010207 photosystem II assembly Biological Process GO:0042549 photosystem II stabilization Biological Process GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0009534 chloroplast thylakoid Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009543 chloroplast thylakoid lumen Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0009579 thylakoid Cellular Component GO:0031977 thylakoid lumen Cellular Component
KEGG gene cross-reference	ath:AT3G01480 ath:AT3G15520 syn:sll0227 syn:sll0408 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.536

Rank 1 · TkA06G190550 · TK1151

Cytoplasm0.415

Rank 2 · TkA06G190550 · TK1151

Mitochondrion0.074

Rank 3 · TkA06G190550 · TK1151

Cell membrane0.056

Rank 4 · TkA06G190550 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkA06G190550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19026UBA_HYPK9-22 aa

PF19026UBA_HYPK24-37 aa

PF26561LETM1_C35-50 aa

PF26561LETM1_C71-84 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G190550	`PF19026`	UBA_HYPK	9	22	0.24	11.5
TkA06G190550	`PF19026`	UBA_HYPK	24	37	0.24	11.5
TkA06G190550	`PF26561`	LETM1_C	35	50	0.21	12.5
TkA06G190550	`PF26561`	LETM1_C	71	84	0.21	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card