TkA06G190540 | RubberDandelionOmics

Gene overview

TkA06G190540

Reference: TK1151 Chr: Chr06 Coordinates: 49711102-49713819 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1980 bp · TkA06G190540|TK1151|cDNA

TTTGTGCTTGAAAATTTGAAATTATTGCTCAAAGTAAAAGGCCACCTACCTTCGTTGAATCCAAATGGACAGTGAACAAGATCTTCTGATCTTATCTAGATAGCCTGAGGCTGAGCTCAATTCAATCCATGTCTCCTTCAAAACCTTATCTCTCCATTTTTAAACAAAACGCTAGTCGTATTTTTTCTTTTGCTTAAAAAATGGCAGCGATTTTCTCTTGCCACTCTTGTTCTTCTCTCTACACCAGTTCTAAATCATCC...

CDS

Download CDS FASTA

1362 bp · TkA06G190540|TK1151|CDS

ATGGCAGCGATTTTCTCTTGCCACTCTTGTTCTTCTCTCTACACCAGTTCTAAATCATCCCTCTTCAACAACCATAAGCAATCGATCAACTACATTCGTCTGTCACATTCCTCCAACAATGCTTCAATTCCACGATTCAGACCAATTTGTTCTTCGCAAAACCCTAATCGACTTCAATTCAGCGACATACAGACAGATAAGTTCTCTGGGATAAAAGAATGTGTGTTATCTGTAGCTTTAGCAATCGGATTGATAACTGG...

Protein

Download Protein FASTA

453 aa · TkA06G190540|TK1151|PROTEIN

MAAIFSCHSCSSLYTSSKSSLFNNHKQSINYIRLSHSSNNASIPRFRPICSSQNPNRLQFSDIQTDKFSGIKECVLSVALAIGLITGVPSFGFPSDANAIAPVIPDLAVLISGPPIKDPGALLRYALPIDNKAIREVQKPLEDITDSLKVSGVKALDSVERNLKQASRALKQGKSMIIAGLAESKKDHAIELLGKLEVGMEELQKIAEDRKRDAVVPKQKELLQYVGGVEEDMVNGFPYEIPEEYQNMPLLKGRATVDMK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G190540`
TK1151 ID	TkA06G190540
OH-1004 ID	LXL04_023991
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.500
Protein coverage (%)	TK1151 98.013 / OH-1004 78.169 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G190540

Location Chr06:49711102-49713819 (+)

Description Similar to CYP38: Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01480`	Required for the assembly and stabilization of PSII, but has no PPIases activity.	A chloroplast cyclophilin functions in the assembly and maintenance of photosystem II in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0707851104 Crystal structure of Arabidopsis cyclophilin38 reveals a previously uncharacterized immunophilin fold and a possible autoinhibitory mechanism.2012 · DOI: 10.1105/tpc.111.093781
`At3g15520`	PPIases accelerate the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023991 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010207 photosystem II assembly Biological Process

GO:0042549 photosystem II stabilization Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0031977 thylakoid lumen Cellular Component

KEGG gene cross-reference

ath:AT3G01480

ath:AT3G15520

syn:sll0227

syn:sll0408

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.988

Rank 1 · TkA06G190540 · TK1151

Mitochondrion0.020

Rank 2 · TkA06G190540 · TK1151

Cytoplasm0.015

Rank 3 · TkA06G190540 · TK1151

Peroxisome0.013

Rank 4 · TkA06G190540 · TK1151

Cell membrane0.012

Rank 5 · TkA06G190540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19793DUF62776-43 aa

PF21329CYP38_PsbQ-like118-234 aa

PF19793DUF6277132-188 aa

PF00160Pro_isomerase187-219 aa

PF00160Pro_isomerase274-433 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G190540	`PF19793`	DUF6277	6	43	0.42	11.5
TkA06G190540	`PF21329`	CYP38_PsbQ-like	118	234	3.9e-44	150.6
TkA06G190540	`PF19793`	DUF6277	132	188	0.42	11.5
TkA06G190540	`PF00160`	Pro_isomerase	187	219	1.7e-23	84.3
TkA06G190540	`PF00160`	Pro_isomerase	274	433	1.7e-23	84.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SSA5`	Arabidopsis thaliana	sp\|Q9SSA5\|CYP38_ARATH Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic	80.300%	Swiss-Prot	High
`P82869`	Arabidopsis thaliana	sp\|P82869\|CYP37_ARATH Peptidyl-prolyl cis-trans isomerase CYP37, chloroplastic	30.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card