TkA06G173270 | RubberDandelionOmics

Gene overview

TkA06G173270

Reference: TK1151 Chr: Chr06 Coordinates: 45491145-45492748 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

954 bp · TkA06G173270|TK1151|cDNA

ATGGCGTACATCACCGATCAGATATTAGCATTGTCGTTACCTGGAGACCTAATTAGAGCCATGCAAAGAAATCTTATGATGCAAGTCAAAGAAGTTTTGGAAAAGAAACATCCTACACACTACAAGGTCTATAACTTATGCATAGAGGAAGACTATGATCCATCCCAGTTTAACGATCTTGTGGAAAGATTCCCGTTTGACGATAATCACGTCCCATCGTTCTCTATGATCAAGGAATTCTGTGAAAGTGTCAATTCCTG...

CDS

Download CDS FASTA

954 bp · TkA06G173270|TK1151|CDS

ATGGCGTACATCACCGATCAGATATTAGCATTGTCGTTACCTGGAGACCTAATTAGAGCCATGCAAAGAAATCTTATGATGCAAGTCAAAGAAGTTTTGGAAAAGAAACATCCTACACACTACAAGGTCTATAACTTATGCATAGAGGAAGACTATGATCCATCCCAGTTTAACGATCTTGTGGAAAGATTCCCGTTTGACGATAATCACGTCCCATCGTTCTCTATGATCAAGGAATTCTGTGAAAGTGTCAATTCCTG...

Protein

Download Protein FASTA

317 aa · TkA06G173270|TK1151|PROTEIN

MAYITDQILALSLPGDLIRAMQRNLMMQVKEVLEKKHPTHYKVYNLCIEEDYDPSQFNDLVERFPFDDNHVPSFSMIKEFCESVNSWLSTDPENIVFINCMGSKGRIGLMVSSYLVYKGMSVQEALQVCANKGTTNTIGVMTPSQRRYVNYWRECLSFPEGCPPEVNLPKPCSRELLRIRLYNHKSIESTFFVVSEMREVHGQRYRSPDDCCRSFCRKVKNSCSEIEEEEEAPKCLEYNFGETVQVTGDVCVAFYEKKIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G173270`
TK1151 ID	TkA06G173270
OH-1004 ID	LXL04_024138
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	69.600
Protein coverage (%)	TK1151 99.054 / OH-1004 77.941 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G173270

Location Chr06:45491145-45492748 (-)

Description Similar to PTEN1: Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and protein-tyrosine-phosphatase PTEN1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39400`	Protein tyrosine phosphatase that also exhibits lipid phosphatase activity.	A tumor suppressor homolog, AtPTEN1, is essential for pollen development in Arabidopsis.2002 · DOI: 10.1105/tpc.005702

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024138 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006470 protein dephosphorylation Biological Process

GO:0006661 phosphatidylinositol biosynthetic process Biological Process

GO:0006935 chemotaxis Biological Process

GO:0007056 spindle assembly involved in female meiosis Biological Process

GO:0007188 adenylate cyclase-modulating G protein-coupled receptor signaling pathway Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0009555 pollen development Biological Process

GO:0010467 gene expression Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0016477 cell migration Biological Process

KEGG gene cross-reference

ath:AT5G39400

cfa:403832

ddi:DDB_G0286557

hsa:5728

mmu:19211

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.635

Rank 1 · TkA06G173270 · TK1151

Nucleus0.273

Rank 2 · TkA06G173270 · TK1151

Cell membrane0.122

Rank 3 · TkA06G173270 · TK1151

Mitochondrion0.090

Rank 4 · TkA06G173270 · TK1151

Golgi apparatus0.078

Rank 5 · TkA06G173270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22785Tc-R-P60-119 aa

PF22784PTP-SAK63-126 aa

PF22741PTP-NADK63-129 aa

PF10409PTEN_C2230-308 aa

PF22918PTEN2_C2243-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G173270	`PF22785`	Tc-R-P	60	119	4.9e-07	31.0
TkA06G173270	`PF22784`	PTP-SAK	63	126	1.1e-05	26.3
TkA06G173270	`PF22741`	PTP-NADK	63	129	6.3e-05	23.2
TkA06G173270	`PF10409`	PTEN_C2	230	308	8e-10	39.3
TkA06G173270	`PF22918`	PTEN2_C2	243	306	0.0035	18.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLZ5`	Arabidopsis thaliana	sp\|Q9FLZ5\|PTEN1_ARATH Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and protein-tyrosine-phosphatase PTEN1	52.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card