RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G172780
Reference: TK1151 Chr: Chr06 Coordinates: 45373600-45375104 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

717 bp · TkA06G172780|TK1151|cDNA

ATGGCGAAGAAGGATAGGTTTCCTGATGCTTATTTTGGTGGATTTCCTCACAATGAGGAATCTGAAGGATCGGGTGGTTCAGGACGTGATCATATGGAAATATCTGGCTCTGAGATCTCTAGTGGCCCAAGAGAGAAATGGATAAAGTTAAGCTCTGCATTACACGATGGTTTTGGTGTCTCTATACAAAGTGTCCCCCTTTCAACATTTCCATCTTCCGAGAAACAAAAATGGTCACTACAATTGCGATCTAAACTTGA...

CDS

Download CDS FASTA

717 bp · TkA06G172780|TK1151|CDS

ATGGCGAAGAAGGATAGGTTTCCTGATGCTTATTTTGGTGGATTTCCTCACAATGAGGAATCTGAAGGATCGGGTGGTTCAGGACGTGATCATATGGAAATATCTGGCTCTGAGATCTCTAGTGGCCCAAGAGAGAAATGGATAAAGTTAAGCTCTGCATTACACGATGGTTTTGGTGTCTCTATACAAAGTGTCCCCCTTTCAACATTTCCATCTTCCGAGAAACAAAAATGGTCACTACAATTGCGATCTAAACTTGA...

Protein

Download Protein FASTA

238 aa · TkA06G172780|TK1151|PROTEIN

MAKKDRFPDAYFGGFPHNEESEGSGGSGRDHMEISGSEISSGPREKWIKLSSALHDGFGVSIQSVPLSTFPSSEKQKWSLQLRSKLDILITFKRKVDTNRDMTSSNIITSNKPQRNQPTSRKASDPQPRINPGNYTHKICYKMWCGMSQQHSQRKSNHGLCYGTMATDFVTTSVTTDLTTEACPRKLLQNHCYGFYNGKISTDFTMEVCQRILLQNYSNGFYNGSLTAEIATTFLLRN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G172780
TK1151 IDTkA06G172780
OH-1004 IDLXL04_006059
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)83.500
Protein coverage (%)TK1151 55.882 / OH-1004 18.963
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G172780
LocationChr06:45373600-45375104 (-)
DescriptionSimilar to GTE9: Transcription factor GTE9
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_006059 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006338 chromatin remodeling Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0006357 regulation of transcription by RNA polymerase II Biological Process
GO:0009409 response to cold Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0045892 negative regulation of DNA-templated transcription Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0051365 cellular response to potassium ion starvation Biological Process
GO:0000785 chromatin Cellular Component
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT1G73150
ath:AT3G01770
ath:AT3G27260
ath:AT5G14270
ath:AT5G63320
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.422
Rank 1 · TkA06G172780 · TK1151
Cytoplasm0.391
Rank 2 · TkA06G172780 · TK1151
Cell membrane0.156
Rank 3 · TkA06G172780 · TK1151
Mitochondrion0.107
Rank 4 · TkA06G172780 · TK1151
Endoplasmic reticulum0.065
Rank 5 · TkA06G172780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser