TkA06G170680 | RubberDandelionOmics

Gene overview

TkA06G170680

Reference: TK1151 Chr: Chr06 Coordinates: 44812285-44815897 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2046 bp · TkA06G170680|TK1151|cDNA

TTTATACATAAACGAGGGAGGATTTCTGTAAAATGAACGGCGGCATCTATCTAACCGTGGTCAGACACATCTATCTACCGTGGCCGATGGGTGCCGGACTCTGTATCCCCAAAAGATAACGCAAGAAGAACATTACCTCAATCAAGTTACGACAGCATGACAGAAGACGATTGCACAAGGGTTTCGATGCCTGAATCGACGCCTGCATCCGATTCATCCAGCACGAAGCAAAGGAAAAAGAGAAAATGGGATCAGCCAGC...

CDS

Download CDS FASTA

723 bp · TkA06G170680|TK1151|CDS

ATGGGATCTTTTGTTGGGATCACACATCCTAATGTCCCTCCAGTTTCTAGCGCTTCTTTGATAAATCCTCTTACTGCTAATTATGGACATTTACAGCAGCTTTTTCCAGCACCCTCAATGCAGCAGCATGCTACTGCACTGCCCCAAAAGATTCAACCAAAGATTCAAGAGGAGTTAATTGCACGAGAAATTGTCATAAATGATGCAGAGTCTTCCATTCGTTACAAGCTTACAAAACGCCAAACACAGAGGAGGATTCA...

Protein

Download Protein FASTA

240 aa · TkA06G170680|TK1151|PROTEIN

MGSFVGITHPNVPPVSSASLINPLTANYGHLQQLFPAPSMQQHATALPQKIQPKIQEELIAREIVINDAESSIRYKLTKRQTQRRIQKCTGSIVITRGKYRPPNAPSDGEKPLYLLFQLPPCGGTTEDRIKAVDQAAAMIEEIMKQGVSPNGSKVVQPFSTCVFLGFEPDPSLNIIARIRGPNDQYVNHIMNEQDHQSYSKGLDLDFLPLQKSNHHHYIYFCQVIIQKALNMQSFLLRTF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G170680`
TK1151 ID	TkA06G170680
OH-1004 ID	LXL04_026656
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	29.400
Protein coverage (%)	TK1151 52.083 / OH-1004 8.970 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G170680

Location Chr06:44812285-44815897 (-)

Description Similar to RH42: DEAD-box ATP-dependent RNA helicase 42

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g29390`	Protein RIK.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026656 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0035196 miRNA processing Biological Process

GO:1903241 U2-type prespliceosome assembly Biological Process

GO:0001650 fibrillar center Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005684 U2-type spliceosomal complex Cellular Component

GO:0015030 Cajal body Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT1G20920

ath:AT3G09620

dosa:Os08g0154200

mmu:212880

rno:245957

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.627

Rank 1 · TkA06G170680 · TK1151

Cytoplasm0.425

Rank 2 · TkA06G170680 · TK1151

Mitochondrion0.052

Rank 3 · TkA06G170680 · TK1151

Cell membrane0.033

Rank 4 · TkA06G170680 · TK1151

Endoplasmic reticulum0.028

Rank 5 · TkA06G170680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26370KDD_N36-109 aa

PF23469KH_1260-148 aa

PF22675KH-I_KHDC4-BBP80-143 aa

PF22675KH-I_KHDC4-BBP170-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G170680	`PF26370`	KDD_N	36	109	0.068	13.7
TkA06G170680	`PF23469`	KH_12	60	148	9.5e-30	103.4
TkA06G170680	`PF22675`	KH-I_KHDC4-BBP	80	143	8.3e-09	35.9
TkA06G170680	`PF22675`	KH-I_KHDC4-BBP	170	196	8.3e-09	35.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIA4`	Arabidopsis thaliana	sp\|Q9LIA4\|RIK_ARATH Protein RIK	64.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card