TkA06G168400 | RubberDandelionOmics

Gene overview

TkA06G168400

Reference: TK1151 Chr: Chr06 Coordinates: 44280087-44282839 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1590 bp · TkA06G168400|TK1151|cDNA

ATGAATCCTTCGGCTATTTTGACGTCGTTAAATGCCGACCTTTTCGAGGGCTGTTCTTACGAACTTCCGCAGCGAATCTGTCACCTCCAGCACCACCACCCTCTCAATCTCCGCCATTGTTATATCGCTTTTTCTTAAACTCTACCACTATATCCATTTATGCGTTAAACAAACATTCTATAGGAAATGGGAATATGTTTCTCAAGAAAATCCACACGATCAACGAGAATCTACTCAAAGCGCGTATCAAATCAATCCAC...

CDS

Download CDS FASTA

1155 bp · TkA06G168400|TK1151|CDS

ATGGGAATATGTTTCTCAAGAAAATCCACACGATCAACGAGAATCTACTCAAAGCGCGTATCAAATCAATCCACTACATCAATCAACAAAAATTCTGTTAACCGATGGTCTCGCGTACGATCTTCTTCCGCTAAGAAGGAAACGTTCGATGATGCTCTTCTTCACGAACAAGCCATCGCCGCCGCTCTCCTCTTCCAGCAACACCAGCAGCAAAACGGCGGTGCCCTGGTTTTTGATCGATCAACTTCTCTCCGGCATCC...

Protein

Download Protein FASTA

384 aa · TkA06G168400|TK1151|PROTEIN

MGICFSRKSTRSTRIYSKRVSNQSTTSINKNSVNRWSRVRSSSAKKETFDDALLHEQAIAAALLFQQHQQQNGGALVFDRSTSLRHPSGGANSKFQQVFPRSSSTRRRSLIDPMLPPQQLINQEVNHDELETSHIVLVHGGGFGAWCWYKSIALLQESKFKVTTIDLSGSGIDMFNANAIKSLSQYVKPLTDFLEKLPDGEKVILAGHDFGGVCISYTMELFPNKVAKAIFIAASMLKTGQSTLDMFSHKENANDLMNQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G168400`
TK1151 ID	TkA06G168400
OH-1004 ID	LXL04_024184
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G168400

Location Chr06:44280087-44282839 (-)

Description Similar to MES11: Putative methylesterase 11, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g29770`	Putative methylesterase.	No verified direct reference in this release
`At1g26360`	Putative methylesterase.	No verified direct reference in this release
`At1g69240`	Putative methylesterase.	No verified direct reference in this release
`At1g33990`	Putative methylesterase.	No verified direct reference in this release
`UniProt: Q940H7`	Putative methylesterase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024184 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009694 jasmonic acid metabolic process Biological Process

GO:0009696 salicylic acid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0080030 methyl indole-3-acetate esterase activity Molecular Function

GO:0080031 methyl salicylate esterase activity Molecular Function

GO:0080032 methyl jasmonate esterase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26360

ath:AT1G33990

ath:AT1G69240

ath:AT3G29770

ath:AT4G09900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.373

Rank 1 · TkA06G168400 · TK1151

Nucleus0.309

Rank 2 · TkA06G168400 · TK1151

Cell membrane0.287

Rank 3 · TkA06G168400 · TK1151

Plastid0.071

Rank 4 · TkA06G168400 · TK1151

Endoplasmic reticulum0.068

Rank 5 · TkA06G168400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_1134-369 aa

PF12146Hydrolase_4134-246 aa

PF12697Abhydrolase_6135-373 aa

PF12695Abhydrolase_5193-258 aa

PF12146Hydrolase_4345-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G168400	`PF00561`	Abhydrolase_1	134	369	3e-16	60.5
TkA06G168400	`PF12146`	Hydrolase_4	134	246	5.2e-09	36.5
TkA06G168400	`PF12697`	Abhydrolase_6	135	373	7.4e-17	63.4
TkA06G168400	`PF12695`	Abhydrolase_5	193	258	0.063	13.8
TkA06G168400	`PF12146`	Hydrolase_4	345	379	5.2e-09	36.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FW03`	Arabidopsis thaliana	sp\|Q9FW03\|MES11_ARATH Putative methylesterase 11, chloroplastic	72.400%	Swiss-Prot	High
`F4IE65`	Arabidopsis thaliana	sp\|F4IE65\|MES13_ARATH Putative methylesterase 13, chloroplastic	58.100%	Swiss-Prot	High
`F4I0K9`	Arabidopsis thaliana	sp\|F4I0K9\|MES15_ARATH Putative methylesterase 15, chloroplastic	60.300%	Swiss-Prot	High
`Q9FVW3`	Arabidopsis thaliana	sp\|Q9FVW3\|MES14_ARATH Putative methylesterase 14, chloroplastic	49.800%	Swiss-Prot	Medium
`Q940H7`	Arabidopsis thaliana	sp\|Q940H7\|MES12_ARATH Putative methylesterase 12, chloroplastic	49.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card