TkA06G164260 | RubberDandelionOmics

Gene overview

TkA06G164260

Reference: TK1151 Chr: Chr06 Coordinates: 43205285-43205812 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · TkA06G164260|TK1151|cDNA

ATGAACCTACACAACAACCCACCAATCATGCAATTTAATCTCAACACACCTTCAAATAATTACCCATTCTACCATCTTCACATGAACCACGGTCAATCCCAATACCAAGAAACTAACCATGAAGCCGATGAACAACAACTAACGATCATCAATGAAAGGAAACAGAGAAGAATGATATCGAACAGAGAGTCGGCAAGAAGGTCACGTATGCGGAAACAGAAGCATTTGGATGAACTTTGGTCGCAGGTGGTTTGGCTTCG...

CDS

Download CDS FASTA

498 bp · TkA06G164260|TK1151|CDS

ATGAACCTACACAACAACCCACCAATCATGCAATTTAATCTCAACACACCTTCAAATAATTACCCATTCTACCATCTTCACATGAACCACGGTCAATCCCAATACCAAGAAACTAACCATGAAGCCGATGAACAACAACTAACGATCATCAATGAAAGGAAACAGAGAAGAATGATATCGAACAGAGAGTCGGCAAGAAGGTCACGTATGCGGAAACAGAAGCATTTGGATGAACTTTGGTCGCAGGTGGTTTGGCTTCG...

Protein

Download Protein FASTA

165 aa · TkA06G164260|TK1151|PROTEIN

MNLHNNPPIMQFNLNTPSNNYPFYHLHMNHGQSQYQETNHEADEQQLTIINERKQRRMISNRESARRSRMRKQKHLDELWSQVVWLRNENHQLVDKLNKFSGTYDQVVQENAQLKEEASELREMVNKLQLSRTYPSLMDLDDINSISNALFLRTESSISSSSEFF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G164260`
TK1151 ID	TkA06G164260
OH-1004 ID	LXL04_024218
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.600
Protein coverage (%)	TK1151 100.000 / OH-1004 93.085 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G164260

Location Chr06:43205285-43205812 (+)

Description Similar to BZIP43: Basic leucine zipper 43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g38800`	Probable transcription factor involved in somatic embryogenesis.	Stress-related function of bHLH109 in somatic embryo induction in Arabidopsis.2016 · DOI: 10.1016/j.jplph.2016.02.012
`At1g68880`	Basic leucine zipper 8.	No verified direct reference in this release
`At3g62420`	May bind specific sequences in target-gene promoters and activate transcription.	A novel subgroup of bZIP proteins functions as transcriptional activators in hypoosmolarity-responsive expression of the ProDH gene in Arabidopsis.2004 · DOI: 10.1093/pcp/pch036 Combinatorial control of Arabidopsis proline dehydrogenase transcription by specific heterodimerisation of bZIP transcription factors.2006 · DOI: 10.1038/sj.emboj.7601206 A pivotal role of the basic leucine zipper transcription factor bZIP53 in the regulation of Arabidopsis seed maturation gene expression based on heterodimerization and protein complex formation.2009 · DOI: 10.1105/tpc.108.062968 Heterodimers of the Arabidopsis transcription factors bZIP1 and bZIP53 reprogram amino acid metabolism during low energy stress.2011 · DOI: 10.1105/tpc.110.075390 A novel method to identify the DNA motifs recognized by a defined transcription factor.2014 · DOI: 10.1007/s11103-014-0234-5
`At1g75390`	Transcription factor that binds to the DNA G-box motif 5'- CACGTG-3' of MAN7 promoter.	Arabidopsis thaliana bZIP44: a transcription factor affecting seed germination and expression of the mannanase-encoding gene AtMAN7.2013 · DOI: 10.1111/tpj.12162
`At2g18160`	Transcription factor that binds to specific DNA sequences in target gene promoters.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024218 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006971 hypotonic response Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009845 seed germination Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:2000693 positive regulation of seed maturation Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G68880

ath:AT1G75390

ath:AT2G18160

ath:AT3G62420

ath:AT5G38800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · TkA06G164260 · TK1151

Cytoplasm0.105

Rank 2 · TkA06G164260 · TK1151

Cell membrane0.020

Rank 3 · TkA06G164260 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkA06G164260 · TK1151

Plastid0.009

Rank 5 · TkA06G164260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05859Mis1225-133 aa

PF04977DivIC27-56 aa

PF28159CEP8931-130 aa

PF14661HAUS6_N34-124 aa

PF06005ZapB36-55 aa

PF14662KASH_CCD38-61 aa

PF06156YabA41-73 aa

PF07989Cnn_1N41-82 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G164260	`PF05859`	Mis12	25	133	0.043	14.3
TkA06G164260	`PF04977`	DivIC	27	56	4.0	8.0
TkA06G164260	`PF28159`	CEP89	31	130	0.0084	15.3
TkA06G164260	`PF14661`	HAUS6_N	34	124	0.18	12.1
TkA06G164260	`PF06005`	ZapB	36	55	0.025	15.8
TkA06G164260	`PF14662`	KASH_CCD	38	61	0.0016	19.2
TkA06G164260	`PF06156`	YabA	41	73	0.0016	19.8
TkA06G164260	`PF07989`	Cnn_1N	41	82	2.2	9.2
TkA06G164260	`PF13863`	DUF4200	47	101	0.005	17.9
TkA06G164260	`PF23594`	RPN11_C	51	51	0.2	12.4
TkA06G164260	`PF07716`	bZIP_2	52	97	1.7e-08	35.1
TkA06G164260	`PF27978`	ZNF318_helical	52	120	0.092	13.9
TkA06G164260	`PF00170`	bZIP_1	53	105	1.8e-15	57.5
TkA06G164260	`PF03131`	bZIP_Maf	53	114	0.0056	17.9
TkA06G164260	`PF28121`	VPA1267	54	105	0.052	14.4
TkA06G164260	`PF05010`	TACC_C	55	157	0.00076	20.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMC2`	Arabidopsis thaliana	sp\|Q9FMC2\|BZP43_ARATH Basic leucine zipper 43	47.100%	Swiss-Prot	Medium
`Q9CA46`	Arabidopsis thaliana	sp\|Q9CA46\|BZIP8_ARATH Basic leucine zipper 8	54.900%	Swiss-Prot	Low
`Q9LZP8`	Arabidopsis thaliana	sp\|Q9LZP8\|BZP53_ARATH bZIP transcription factor 53	44.200%	Swiss-Prot	Medium
`C0Z2L5`	Arabidopsis thaliana	sp\|C0Z2L5\|BZP44_ARATH bZIP transcription factor 44	47.700%	Swiss-Prot	Medium
`Q9SI15`	Arabidopsis thaliana	sp\|Q9SI15\|BZIP2_ARATH bZIP transcription factor 2	46.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card