TkA06G160640 | RubberDandelionOmics

Gene overview

TkA06G160640

Reference: TK1151 Chr: Chr06 Coordinates: 42338488-42339301 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

710 bp · TkA06G160640|TK1151|cDNA

AGCAAAACCCTCGATTGGCTCTTCACCAAATCCAAAACCGCCATTAAAGACTTGCTTGAAGAAAAAAAGCAAACTTCATCTTCTTCAACTCTTACCGACCAATGTGAAGAAGTTTTCATGGAGAAAGGAGACCATGTCGAAAAGATCAAGGGCAAAAAGAAGAAACCAGTAACTAAATGCGTTAATGGCGGAAAAAGAAAGAAGAAAACATCACAAAAAAATCTGAAACCTGGATTCCATGTGAATCTTGCAGCTAGAAA...

CDS

Download CDS FASTA

528 bp · TkA06G160640|TK1151|CDS

AGCAAAACCCTCGATTGGCTCTTCACCAAATCCAAAACCGCCATTAAAGACTTGCTTGAAGAAAAAAAGCAAACTTCATCTTCTTCAACTCTTACCGACCAATGTGAAGAAGTTTTCATGGAGAAAGGAGACCATGTCGAAAAGATCAAGGGCAAAAAGAAGAAACCAGTAACTAAATGCGTTAATGGCGGAAAAAGAAAGAAGAAAACATCACAAAAAAATCTGAAACCTGGATTCCATGTGAATCTTGCAGCTAGAAA...

Protein

Download Protein FASTA

175 aa · TkA06G160640|TK1151|PROTEIN

SKTLDWLFTKSKTAIKDLLEEKKQTSSSSTLTDQCEEVFMEKGDHVEKIKGKKKKPVTKCVNGGKRKKKTSQKNLKPGFHVNLAARNQLRAEARARARERTIQKSRNKTQNNNDCKNVVDDDRNYCYLQSQSNHEARIGESSFMEQKLPKPYSLIYTSNHSFLESKNSHFKNNLQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G160640`
TK1151 ID	TkA06G160640
OH-1004 ID	LXL04_024238
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.000
Protein coverage (%)	TK1151 100.000 / OH-1004 57.566 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G160640`
Location	Chr06:42338488-42339301 (+)
Description	Similar to CYC: Transcription factor CYCLOIDEA (Fragment)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024238` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0009799 specification of symmetry Biological Process GO:0009908 flower development Biological Process GO:0048262 determination of dorsal/ventral asymmetry Biological Process GO:2000032 regulation of secondary shoot formation Biological Process GO:0005634 nucleus Cellular Component GO:0003677 DNA binding Molecular Function GO:0003700 DNA-binding transcription factor activity Molecular Function GO:0043565 sequence-specific DNA binding Molecular Function
KEGG gene cross-reference	ath:AT1G67260 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.925

Rank 1 · TkA06G160640 · TK1151

Cytoplasm0.153

Rank 2 · TkA06G160640 · TK1151

Cell membrane0.027

Rank 3 · TkA06G160640 · TK1151

Mitochondrion0.019

Rank 4 · TkA06G160640 · TK1151

Endoplasmic reticulum0.013

Rank 5 · TkA06G160640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03634TCP1-107 aa

PF02637GatB_Yqey4-58 aa

PF17378REC1049-22 aa

PF02064MAS2011-44 aa

PF00264Tyrosinase28-138 aa

PF09745NSRP1_N65-112 aa

PF02064MAS2086-145 aa

PF17378REC104106-154 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G160640	`PF03634`	TCP	1	107	5.6e-11	43.9
TkA06G160640	`PF02637`	GatB_Yqey	4	58	0.0011	19.6
TkA06G160640	`PF17378`	REC104	9	22	0.045	14.2
TkA06G160640	`PF02064`	MAS20	11	44	6.3	7.2
TkA06G160640	`PF00264`	Tyrosinase	28	138	0.26	12.3
TkA06G160640	`PF09745`	NSRP1_N	65	112	0.016	15.9
TkA06G160640	`PF02064`	MAS20	86	145	6.3	7.2
TkA06G160640	`PF17378`	REC104	106	154	0.045	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card