TkA06G154410 | RubberDandelionOmics

Gene overview

TkA06G154410

Reference: TK1151 Chr: Chr06 Coordinates: 40384196-40385476 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

913 bp · TkA06G154410|TK1151|cDNA

TTCATTACCATCTTCACCTTCATCATATTTAATGCATTTCCATCTTTAGATTCAATCAAATTCATAGCTGTATATAAAATCAGGGATACAATTAACTCTCTTTCCTTCTCAATATGTTTTTAATTGAATCATTATTCGCTGATTTTGTCTGGTTGTTGAATCTGTGAGCAATGGCAGCTTCCTCTTCAAGAGGACAAAGCAGTTCACCATTCCCCAACCACAAGCCTTCAAGTCCATTTTCATCATCTTCATCATCTTCT...

CDS

Download CDS FASTA

594 bp · TkA06G154410|TK1151|CDS

ATGGCAGCTTCCTCTTCAAGAGGACAAAGCAGTTCACCATTCCCCAACCACAAGCCTTCAAGTCCATTTTCATCATCTTCATCATCTTCTTCTTTCAAGCAGACTGCACATCAATCATCATCTTCTGCTGCAACTTTCAACGGAGGCTCGGGGAACGGTTACGGTTCGAGATCTGATACTCTTGGTCGGACTACATCTGATTCGATGTACTCCCGAGGTGGTTACGAAGCGCCTTCGCCTGTAGATTATCCGTCTGTCGA...

Protein

Download Protein FASTA

197 aa · TkA06G154410|TK1151|PROTEIN

MAASSSRGQSSSPFPNHKPSSPFSSSSSSSSFKQTAHQSSSSAATFNGGSGNGYGSRSDTLGRTTSDSMYSRGGYEAPSPVDYPSVDELLDEPIDEFSRPTGGDSISVTIRFRPLSEREYQRGDEVAWYADGDKLVRNEYNPATSYAFDKVFGSFAETHEVYEVAAGPVIRAAMEGINGTVFAYGVKAAVGKHILCR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G154410`
TK1151 ID	TkA06G154410
OH-1004 ID	LXL04_029499
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.200
Protein coverage (%)	TK1151 98.985 / OH-1004 96.059 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G154410

Location Chr06:40384196-40385476 (-)

Description Similar to KIN7D: Kinesin-like protein KIN-7D, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39050`	Kinesin-like protein KIN-7D, mitochondrial.	No verified direct reference in this release
`At2g21380`	Kinesin-like protein KIN-7M, chloroplastic.	No verified direct reference in this release
`At3g12020`	Kinesin-like protein KIN-7K, chloroplastic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0512800`	Kinesin-like protein KIN-7K, chloroplastic.	No verified direct reference in this release
`Os04g0434600`	Kinesin-like protein KIN-7E, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029499 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G21730

ath:AT2G21380

ath:AT4G39050

osa:9271714

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.325

Rank 1 · TkA06G154410 · TK1151

Nucleus0.276

Rank 2 · TkA06G154410 · TK1151

Plastid0.232

Rank 3 · TkA06G154410 · TK1151

Cell membrane0.131

Rank 4 · TkA06G154410 · TK1151

Endoplasmic reticulum0.084

Rank 5 · TkA06G154410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00225Kinesin111-188 aa

PF16796Microtub_bd129-186 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G154410	`PF00225`	Kinesin	111	188	8.5e-13	48.7
TkA06G154410	`PF16796`	Microtub_bd	129	186	0.008	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W5R5`	Arabidopsis thaliana	sp\|Q8W5R5\|KN7D_ARATH Kinesin-like protein KIN-7D, mitochondrial	53.100%	Swiss-Prot	High
`Q9SJU0`	Arabidopsis thaliana	sp\|Q9SJU0\|KN7M_ARATH Kinesin-like protein KIN-7M, chloroplastic	50.500%	Swiss-Prot	High
`F4J8L3`	Arabidopsis thaliana	sp\|F4J8L3\|KN7K_ARATH Kinesin-like protein KIN-7K, chloroplastic	55.400%	Swiss-Prot	Low
`Q9FW70`	Oryza sativa subsp. japonica	sp\|Q9FW70\|KN7K_ORYSJ Kinesin-like protein KIN-7K, chloroplastic	63.600%	Swiss-Prot	Medium
`B9FFA3`	Oryza sativa subsp. japonica	sp\|B9FFA3\|KN7E_ORYSJ Kinesin-like protein KIN-7E, chloroplastic	62.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card