TkA06G149770 | RubberDandelionOmics

Gene overview

TkA06G149770

Reference: TK1151 Chr: Chr06 Coordinates: 39284800-39286580 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1661 bp · TkA06G149770|TK1151|cDNA

TCTAAACCCTCATTGTAGCCTCCCCTCTTCAAAAGTCTACTTATGTTCCATCATTTTCTCAAAAACTAAAGCTGCTTTGCCCTTCAACCATCATACCTATTCCATCTTTCTTTAAGAAATACGATGTTGATCAGTCTATTTTTCTTAGATTTGTATCCAGATTTCATACAAATAATGTTTCATATCCCGATATACCCAGAACCTAGAGGTACCACTTTCTAGTCCGGTCGCCATCCTTCTTTCTCTCTTTCTTTTATCTC...

CDS

Download CDS FASTA

1254 bp · TkA06G149770|TK1151|CDS

ATGATGCAGTTCACTGAGACATTACCAGCACCACCACTCCATCTCTCCACAAAACCATGCCAAAACTTCACTCCTATGAATCCAAACCAAATCCACCGTACGCCACCGTGGCCTGGGTTTCCGGCTCCTAACAAGGCGCTGGGAACCTTCGGAGATGCCAATTGCATGGAGCAGTTGCTTGTTCGATGTGCTAATGCCATCGAAAGCAATGACGCGACTCTCTCTCAACAAATCTTGTGGGTTCTTAACAACATCGCGCC...

Protein

Download Protein FASTA

417 aa · TkA06G149770|TK1151|PROTEIN

MMQFTETLPAPPLHLSTKPCQNFTPMNPNQIHRTPPWPGFPAPNKALGTFGDANCMEQLLVRCANAIESNDATLSQQILWVLNNIAPSDGDSNQRLTCGFLRALIARAAKTGTSANAAILEAVEGYSTVHIIDLSLTHCMQIPTLIDAMAGKLEGPPIVKLTIAGATEDVPPMLDLSYDELGIKLVNFARSRNIILEFNVIPSSSSDGFSSLIEHLKLRNLVHGNETTNEALVINCHMMLHYIPEETTQTTTTSSTTPFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G149770`
TK1151 ID	TkA06G149770
OH-1004 ID	LXL04_024386
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G149770

Location Chr06:39284800-39286580 (+)

Description Similar to SCL32: Scarecrow-like protein 32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49950`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At5g67411`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At1g21450`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At4g17230`	Probable transcription factor that acts as a positive regulator of continuous red light signals downstream of phytochrome B (phyB).	The GRAS protein SCL13 is a positive regulator of phytochrome-dependent red light signaling, but can also modulate phytochrome A responses.2006 · DOI: 10.1007/s00438-006-0123-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024386 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0009956 radial pattern formation Biological Process

GO:0032350 regulation of hormone metabolic process Biological Process

GO:0045930 negative regulation of mitotic cell cycle Biological Process

GO:0048366 leaf development Biological Process

GO:0060586 multicellular organismal-level iron ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005770 late endosome Cellular Component

GO:0055037 recycling endosome Cellular Component

KEGG gene cross-reference

ath:AT3G49950

ath:AT4G37650

ath:AT5G67411

dosa:Os07g0586900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.599

Rank 1 · TkA06G149770 · TK1151

Cytoplasm0.424

Rank 2 · TkA06G149770 · TK1151

Cell membrane0.075

Rank 3 · TkA06G149770 · TK1151

Endoplasmic reticulum0.060

Rank 4 · TkA06G149770 · TK1151

Plastid0.042

Rank 5 · TkA06G149770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514GRAS56-113 aa

PF03514GRAS114-414 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G149770	`PF03514`	GRAS	56	113	1.2e-79	268.7
TkA06G149770	`PF03514`	GRAS	114	414	1.2e-79	268.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN22`	Arabidopsis thaliana	sp\|Q9SN22\|SCL32_ARATH Scarecrow-like protein 32	56.000%	Swiss-Prot	High
`Q2V2T9`	Arabidopsis thaliana	sp\|Q2V2T9\|SCL16_ARATH Putative scarecrow-like protein 16	55.700%	Swiss-Prot	Medium
`Q9SDQ3`	Arabidopsis thaliana	sp\|Q9SDQ3\|SCL1_ARATH Scarecrow-like protein 1	23.800%	Swiss-Prot	Low
`Q9M0M5`	Arabidopsis thaliana	sp\|Q9M0M5\|SCL13_ARATH Scarecrow-like protein 13	25.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card