TkA06G144310 | RubberDandelionOmics

Gene overview

TkA06G144310

Reference: TK1151 Chr: Chr06 Coordinates: 37804926-37807327 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1384 bp · TkA06G144310|TK1151|cDNA

TTTTCTATTTTTCTATTCATTTTTAATTTTCTTGACCATCTTAATTCCACTCCACAGACCATATTCCATATTCTTCGGATTCATTCATCTCGTTTTAAAGCACCATCATCATATATATTTTTCCACACCCCACACCCACCGCCTTACCAATTATTTCCCTTCATAATATCTTCATCGAATTCCTCTTTCTTCTTACACACTTCCATCTTCAATTCTCTGATCATAAATCCCACAATCAGATGGAGTTCGAGAGTCTTTCT...

CDS

Download CDS FASTA

831 bp · TkA06G144310|TK1151|CDS

ATGGAGTTCGAGAGTCTTTCTGACGCAGGACTTGTTTTAGGACTAAGCCTTAACGCATCACCATCCATGGCCACACCTAATTACATCACGACAAAGCAGCCGTGTGTGACGGAGACGATGTCGAGTTTTGAGCCGTCGTTAACGTTAGGTCTTTCTGGAGACCCTAATCGGAAAGTTGTGGTCGGAGGAGATCAGGGTGGTTTGTGTCGACAGGATAGTACGGTGATCAGTGGTGGAGGGTCTTCGTTTTCAAACGTGAG...

Protein

Download Protein FASTA

276 aa · TkA06G144310|TK1151|PROTEIN

MEFESLSDAGLVLGLSLNASPSMATPNYITTKQPCVTETMSSFEPSLTLGLSGDPNRKVVVGGDQGGLCRQDSTVISGGGSSFSNVSVKRDREVGSEESERVSNENISNSRVMSTSVDDVEDDDDGSINGRKKLRLTKPQSALLEEAFKLHTSLNPQKQKQELARELKLRPRQVEVWFQNRRARTKLKQTEMDFEQLKKCCETLRDDNRRLHKELQELKALKSSQPFYMQLPAATLTMCPSCERIGDTKSSAVKNPFNIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G144310`
TK1151 ID	TkA06G144310
OH-1004 ID	LXL04_024435
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G144310

Location Chr06:37804926-37807327 (-)

Description Similar to HAT22: Homeobox-leucine zipper protein HAT22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37790`	Probable transcription factor.	No verified direct reference in this release
`At2g22800`	Probable transcription factor.	No verified direct reference in this release
`At5g06710`	Probable transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YW03`	Probable transcription factor.	No verified direct reference in this release
`Os08g0465000`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024435 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function

GO:0001217 DNA-binding transcription repressor activity Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G22800

ath:AT4G37790

ath:AT5G06710

osa:9271357

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.983

Rank 1 · TkA06G144310 · TK1151

Cytoplasm0.071

Rank 2 · TkA06G144310 · TK1151

Cell membrane0.021

Rank 3 · TkA06G144310 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA06G144310 · TK1151

Plastid0.009

Rank 5 · TkA06G144310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13476AAA_2388-222 aa

PF00046Homeodomain131-186 aa

PF02183HALZ157-168 aa

PF05920Homeobox_KN158-184 aa

PF24627PUMA_CC160-168 aa

PF25450Rab11-FIP3175-219 aa

PF24627PUMA_CC183-220 aa

PF02183HALZ188-222 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G144310	`PF13476`	AAA_23	88	222	0.072	14.4
TkA06G144310	`PF00046`	Homeodomain	131	186	2.5e-13	50.3
TkA06G144310	`PF02183`	HALZ	157	168	4.1e-09	37.2
TkA06G144310	`PF05920`	Homeobox_KN	158	184	0.00012	22.5
TkA06G144310	`PF24627`	PUMA_CC	160	168	1.2	9.9
TkA06G144310	`PF25450`	Rab11-FIP3	175	219	0.15	13.0
TkA06G144310	`PF24627`	PUMA_CC	183	220	1.2	9.9
TkA06G144310	`PF02183`	HALZ	188	222	4.1e-09	37.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P46604`	Arabidopsis thaliana	sp\|P46604\|HAT22_ARATH Homeobox-leucine zipper protein HAT22	56.700%	Swiss-Prot	High
`P46603`	Arabidopsis thaliana	sp\|P46603\|HAT9_ARATH Homeobox-leucine zipper protein HAT9	54.600%	Swiss-Prot	High
`P46665`	Arabidopsis thaliana	sp\|P46665\|HAT14_ARATH Homeobox-leucine zipper protein HAT14	70.400%	Swiss-Prot	Low
`A2YW03`	Oryza sativa subsp. indica	sp\|A2YW03\|HOX27_ORYSI Homeobox-leucine zipper protein HOX27	70.200%	Swiss-Prot	Low
`Q6YPD0`	Oryza sativa subsp. japonica	sp\|Q6YPD0\|HOX27_ORYSJ Homeobox-leucine zipper protein HOX27	70.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card