TkA06G143550 | RubberDandelionOmics

Gene overview

TkA06G143550

Reference: TK1151 Chr: Chr06 Coordinates: 37620727-37623497 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1718 bp · TkA06G143550|TK1151|cDNA

TATAAACACACAAAAGTAAGTTTATATTAGAATACTAGTCTAAATGTAGTTGGATAATCCTATCACCTTTAATACATTTCTGCAACGAAATTTCAATCTTCCCATCTCGTTTCCCAATTGAATAGACCTGAATTGATAATTGAGGAAGATAAACCCCAATCTTCATCACACTTCCCAAAGTGCAAACAACCTTTTCGTCGTCATCATCTCTATTTTGTCTTTCTTTCTCTTCGTGATCTCTACTCACACACTATACATAT...

CDS

Download CDS FASTA

654 bp · TkA06G143550|TK1151|CDS

ATGAAGCAGCACGGCGGAGGAGATGTTAGTCAACGCATCGCAACAATCTCAGCTCACCTAAATCCTCATAAACTCCAGATGGAAAGAAGTTCCGGTTTAGAATCAGCAATTTGCAGAGCAAAAGGCGGAGCAGCAGGATACCGAGTAGCTATATTGGGAGCAGCTGGAGGCATTGGTCAGCCACTTTCCATGTTAATGAAGATGAATCCATTGGTGTCCCTTCTCCATCTTTACGATGTTGCCAATACTCCTGGTGTCAC...

Protein

Download Protein FASTA

217 aa · TkA06G143550|TK1151|PROTEIN

MKQHGGGDVSQRIATISAHLNPHKLQMERSSGLESAICRAKGGAAGYRVAILGAAGGIGQPLSMLMKMNPLVSLLHLYDVANTPGVTSDISHMDTSAVVRGFLGPQQLENALTGMDLVIIPAGVPRKPGMTRDDLFNINAGIVKTLCEGVAKCCPKAIVNIISNPVNSTVPIAAEVFKNVGRMIQGGFWELQCLMLLEPILLWLKFWDLIQGKLMFQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G143550`
TK1151 ID	TkA06G143550
OH-1004 ID	LXL04_024441
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.300
Protein coverage (%)	TK1151 83.410 / OH-1004 52.674 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G143550

Location Chr06:37620727-37623497 (-)

Description Similar to Malate dehydrogenase, glyoxysomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22780`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2
`At5g09660`	Catalyzes a reversible NAD-dependent dehydrogenase reaction involved in central metabolism and redox homeostasis between organelle compartments (Probable).	Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate dehydrogenase is absent.2010 · DOI: 10.1007/s11103-009-9554-2

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024441 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0031998 regulation of fatty acid beta-oxidation Biological Process

GO:0080093 regulation of photorespiration Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009514 glyoxysome Cellular Component

GO:0030060 L-malate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT2G22780

csv:101219252

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.919

Rank 1 · TkA06G143550 · TK1151

Cytoplasm0.076

Rank 2 · TkA06G143550 · TK1151

Nucleus0.053

Rank 3 · TkA06G143550 · TK1151

Plastid0.040

Rank 4 · TkA06G143550 · TK1151

Cell membrane0.021

Rank 5 · TkA06G143550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00056Ldh_1_N48-184 aa

PF01118Semialdhyde_dh48-93 aa

PF01113DapB_N48-119 aa

PF010733Beta_HSD51-154 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G143550	`PF00056`	Ldh_1_N	48	184	4.3e-44	150.7
TkA06G143550	`PF01118`	Semialdhyde_dh	48	93	0.017	16.3
TkA06G143550	`PF01113`	DapB_N	48	119	0.05	14.4
TkA06G143550	`PF01073`	3Beta_HSD	51	154	2.4e-05	24.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82399`	Arabidopsis thaliana	sp\|O82399\|MDHX1_ARATH Malate dehydrogenase 1, peroxisomal	81.800%	Swiss-Prot	High
`Q9ZP05`	Arabidopsis thaliana	sp\|Q9ZP05\|MDHX2_ARATH Malate dehydrogenase 2, peroxisomal	79.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card