Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1034 bp · TkA06G138760|TK1151|cDNA
ATATCAATAGCCGGTCAACGATATAAATACATCGCAGAACACGAAAAACATACGCCATTCTTCTCCGACAACAAGATTTCTCTACTCCTTCATATTCTAGTTCCTAATTTTCGTCCATCAACGTCTTCGATTTCGTTCGCAGTCTAGGGTTTTAAAAATTCTGATGAAGGATTCGAGAGCTAGGGTTTTTAATCGACTGTAGCAGATTATATATTCGGTTGATTCGCGCACTTTTTCTCGTTTTAAGTTTCTACAATGAG...
558 bp · TkA06G138760|TK1151|CDS
ATGAGCGCAGTGAACATTACGAACGTGACGGTGCTGGATAATCCGGCCTCATTTCTCACGCCTTTCCAGTTTGAAATCTCTTACGAGTGTGTTTCGCCTCTCAAAGAAGATCTTGAATGGAAACTGATCTATGTTGGATCTGCTGAGGATGAAACTTACGACCAACTTCTAGAAAGTGTACTTGTGGGACCCGTCAACGTTGGAAACTACCGTTTTGTTTTTCAGGCGGATCCGCCTGACCCATCAAAGATCCGTGAAGA...
Protein
Download Protein FASTA185 aa · TkA06G138760|TK1151|PROTEIN
MSAVNITNVTVLDNPASFLTPFQFEISYECVSPLKEDLEWKLIYVGSAEDETYDQLLESVLVGPVNVGNYRFVFQADPPDPSKIREEDIIGVTVLLLTCSYVGQEFVRVGYYVNNDYDDEKLKEEPPQKVIVDKVQRNILTDKPRVTKFPINFHPENTEQGQGESSQPQGGGENGGGGGGDKAEP
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G138760 |
|---|---|
| TK1151 ID | TkA06G138760 |
| OH-1004 ID | LXL04_024487 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 94.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G138760 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:36348748-36350635 (-) | |||||||||
| Description | Similar to ASF1B: Histone chaperone ASF1B | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006281 DNA repair Biological Process GO:0006325 chromatin organization Biological Process GO:0006334 nucleosome assembly Biological Process GO:0006335 DNA replication-dependent chromatin assembly Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006606 protein import into nucleus Biological Process GO:0008361 regulation of cell size Biological Process GO:0009294 DNA-mediated transformation Biological Process GO:0010091 trichome branching Biological Process GO:0031297 replication fork processing Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G66740 ath:AT5G38110 dme:Dmel_CG9383 gga:723780 hsa:25842 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04729ASF1_hist_chap1-154 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G138760 | PF04729 | ASF1_hist_chap | 1 | 154 | 1.2e-73 | 246.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.