TkA06G137940 | RubberDandelionOmics

Gene overview

TkA06G137940

Reference: TK1151 Chr: Chr06 Coordinates: 36123473-36125302 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

861 bp · TkA06G137940|TK1151|cDNA

ACCATATACTTTCCTAAATCCAACAATCCGCAAGGGTATAACAGTCATTTACTAGCTAACCCTAAATCTCCTTTCACTTTGATCCCATATATTTCTTCTCTTCAATCGCCGTTGGAATCTTCTTCCCAAAACCCTACGCCGTACCAGAAGAAGAAGGTAACAATGAAGTATAACCCACGCGTCACCAGCTCTCGCCGGAAATGCCGCAAGGCTCACTTCTCCGCGCCGTCAAGCGTCCGCCGGGTGCTAATGAGCGCACC...

CDS

Download CDS FASTA

612 bp · TkA06G137940|TK1151|CDS

ACCATATACTTTCCTAAATCCAACAATCCGCAAGGGTATAACAGTCATTTACTAGCTAACCCTAAATCTCCTTTCACTTTGATCCCATATATTTCTTCTCTTCAATCGCCGTTGGAATCTTCTTCCCAAAACCCTACGCCGTACCAGAAGAAGAAGGTAACAATGAAGTATAACCCACGCGTCACCAGCTCTCGCCGGAAATGCCGCAAGGCTCACTTCTCCGCGCCGTCAAGCGTCCGCCGGGTGCTAATGAGCGCACC...

Protein

Download Protein FASTA

203 aa · TkA06G137940|TK1151|PROTEIN

TIYFPKSNNPQGYNSHLLANPKSPFTLIPYISSLQSPLESSSQNPTPYQKKKVTMKYNPRVTSSRRKCRKAHFSAPSSVRRVLMSAPLSTDLRSKYNARSIPVRKDDEVQVVRGTYKGREGKVVQVYRRKWVIHIERITREKVNGQTVNVGINPSKVVVTKLKLDKDRKSLLERKAKGRAADKSKGKFTVDDVAAGASLQEID

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G137940`
TK1151 ID	TkA06G137940
OH-1004 ID	LXL04_024494
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 73.399 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G137940

Location Chr06:36123473-36125302 (+)

Description Similar to RPL26A: 60S ribosomal protein L26-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g49910`	Large ribosomal subunit protein uL24z.	No verified direct reference in this release
`At5g67510`	Large ribosomal subunit protein uL24y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024494 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006412 translation Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0015934 large ribosomal subunit Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

KEGG gene cross-reference

ath:AT3G49910

ath:AT5G67510

hsa:51121

ocu:100347930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.643

Rank 1 · TkA06G137940 · TK1151

Plastid0.282

Rank 2 · TkA06G137940 · TK1151

Nucleus0.180

Rank 3 · TkA06G137940 · TK1151

Mitochondrion0.089

Rank 4 · TkA06G137940 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA06G137940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16906Ribosomal_L2662-175 aa

PF23291KOW4_SPT5102-129 aa

PF00467KOW105-136 aa

PF25092SH3_KIN17_C108-149 aa

PF04379DUF525122-148 aa

PF00467KOW150-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G137940	`PF16906`	Ribosomal_L26	62	175	6.3e-37	126.6
TkA06G137940	`PF23291`	KOW4_SPT5	102	129	3e-05	24.6
TkA06G137940	`PF00467`	KOW	105	136	3.2e-08	33.8
TkA06G137940	`PF25092`	SH3_KIN17_C	108	149	0.024	15.7
TkA06G137940	`PF04379`	DUF525	122	148	0.24	12.4
TkA06G137940	`PF00467`	KOW	150	159	3.2e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51414`	Arabidopsis thaliana	sp\|P51414\|RL261_ARATH Large ribosomal subunit protein uL24z	81.500%	Swiss-Prot	High
`Q9FJX2`	Arabidopsis thaliana	sp\|Q9FJX2\|RL262_ARATH Large ribosomal subunit protein uL24y	80.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card