TkA06G136480 | RubberDandelionOmics

Gene overview

TkA06G136480

Reference: TK1151 Chr: Chr06 Coordinates: 35704967-35706541 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1013 bp · TkA06G136480|TK1151|cDNA

GCCCATTTCAAAGAAAGCAACACAAAGGCCCGTTGGAAAAGCACCGTAGAATCCAACGAATCGAACTCGAACTTCTCAAAGCTGCTTTCCCCAAACCATACGGAGAAAGATCAATTTTCCGGTTCCGGTACCTAACGGAGAGCTCGTCACTCTAATTCAATCTCGATTCTCCACTTTCGGTGAAATTTCACTTTGCTTTCTTCGGTACGAATCATAGTCTTAATGAAATGTTTTAGCGACATGGAAGATAACACACGGTC...

CDS

Download CDS FASTA

369 bp · TkA06G136480|TK1151|CDS

ATGCTTGTTCCAAATAATACGATTGGGTGTCTTTTGGGTAAAAGAGGAGATGTTATTCAGAGATTAAGGAAAGAAACTCATGCAAATATACGTATTTTGGCTCCAGATCAGCTTCCTGTTTGTGGTTTGAAAACCGATGAGTTACTTCAGATATCAGGTAAACCGGATATTGTAAAGAGGGCTATTTATGAAGTTTCAAGATTATTGCATGAAAATCCACGTCCTTCTGGATTCCCGATTCCTTTTGGGCACCAAGGGTT...

Protein

Download Protein FASTA

122 aa · TkA06G136480|TK1151|PROTEIN

MLVPNNTIGCLLGKRGDVIQRLRKETHANIRILAPDQLPVCGLKTDELLQISGKPDIVKRAIYEVSRLLHENPRPSGFPIPFGHQGFRAMTNLPPPVVARFQSAAMDLKITGRGSGNALLVR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G136480`
TK1151 ID	TkA06G136480
OH-1004 ID	LXL04_024515
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.200
Protein coverage (%)	TK1151 86.885 / OH-1004 42.570 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G136480

Location Chr06:35704967-35706541 (-)

Description Similar to At4g18375: KH domain-containing protein At4g18375

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64390`	Functions in floral reproductive organ identity in the third whorl and floral determinacy specification by specifically promoting the processing of AGAMOUS (AG) pre-mRNA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024515 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0010286 heat acclimation Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0031053 primary miRNA processing Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G04610

ath:AT4G18375

ath:AT5G53060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.582

Rank 1 · TkA06G136480 · TK1151

Nucleus0.483

Rank 2 · TkA06G136480 · TK1151

Cell membrane0.054

Rank 3 · TkA06G136480 · TK1151

Mitochondrion0.042

Rank 4 · TkA06G136480 · TK1151

Endoplasmic reticulum0.036

Rank 5 · TkA06G136480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00013KH_11-65 aa

PF22675KH-I_KHDC4-BBP6-32 aa

PF24668KH_Vigilin16-32 aa

PF24668KH_Vigilin49-65 aa

PF22675KH-I_KHDC4-BBP108-117 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G136480	`PF00013`	KH_1	1	65	4.3e-14	52.7
TkA06G136480	`PF22675`	KH-I_KHDC4-BBP	6	32	0.0023	18.5
TkA06G136480	`PF24668`	KH_Vigilin	16	32	0.3	11.6
TkA06G136480	`PF24668`	KH_Vigilin	49	65	0.3	11.6
TkA06G136480	`PF22675`	KH-I_KHDC4-BBP	108	117	0.0023	18.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KDN0`	Arabidopsis thaliana	sp\|F4KDN0\|HEN4_ARATH KH domain-containing protein HEN4	33.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card