TkA06G135430 | RubberDandelionOmics

Gene overview

TkA06G135430

Reference: TK1151 Chr: Chr06 Coordinates: 35410549-35411658 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1110 bp · TkA06G135430|TK1151|cDNA

ATGAGGATTCTCGAACGTTCTGGATTGGGTGAAGAAACGAGTTTGCCGCCGGCGATTCATTACATCCCGCCTAGCCCTAACATGGAGGCCGCTAGGGGGGAGGCGGAGCTCGTGATTTTTTCCGCCGTCGATTCTCTTTTTGCGAGAACAGGTTTGAAACCGAAAGACATAGATATTCTTATAGTGAATTGTAGCCTGTTTTCGCCGACACCGTCGTTGTCGGCGATGGTGGTGAATAAGTATAAGCTGAGGAGTAACAT...

CDS

Download CDS FASTA

1110 bp · TkA06G135430|TK1151|CDS

ATGAGGATTCTCGAACGTTCTGGATTGGGTGAAGAAACGAGTTTGCCGCCGGCGATTCATTACATCCCGCCTAGCCCTAACATGGAGGCCGCTAGGGGGGAGGCGGAGCTCGTGATTTTTTCCGCCGTCGATTCTCTTTTTGCGAGAACAGGTTTGAAACCGAAAGACATAGATATTCTTATAGTGAATTGTAGCCTGTTTTCGCCGACACCGTCGTTGTCGGCGATGGTGGTGAATAAGTATAAGCTGAGGAGTAACAT...

Protein

Download Protein FASTA

369 aa · TkA06G135430|TK1151|PROTEIN

MRILERSGLGEETSLPPAIHYIPPSPNMEAARGEAELVIFSAVDSLFARTGLKPKDIDILIVNCSLFSPTPSLSAMVVNKYKLRSNIKSFNLSGMGCSAGLISIDLARDLLQVLPNSNAMVVSTEIITPNYYQGNERAMLLPNCLFRMGAAALLLSNKRRDRSRAKYKLVHVVRTHKGADDRSYKCVYEQEDPQGLVGINLSKDLMVIAAEALKSNITTIGPLVLPASEQLLFLFTLIGRKIFNPKWKPYIPDFKLAFEH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G135430`
TK1151 ID	TkA06G135430
OH-1004 ID	LXL04_024522
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 74.395 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G135430

Location Chr06:35410549-35411658 (+)

Description Similar to CUT1: 3-ketoacyl-CoA synthase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68530`	Contributes to cuticular wax and suberin biosynthesis.	CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme.1999 · DOI: 10.1105/tpc.11.5.825 Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems.2000 · DOI: 10.1105/tpc.12.10.2001
`At1g25450`	Mediates mostly the synthesis of very-long-chain fatty acids (VLCFAs) from 26 to 30 carbons in length.	Specific and differential inhibition of very-long-chain fatty acid elongases from Arabidopsis thaliana by different herbicides.2004 · DOI: 10.1073/pnas.0404600101
`At1g19440`	3-ketoacyl-CoA synthase 4.	No verified direct reference in this release
`At2g16280`	Involved in the elongation of C22 to C24 fatty acids, which are precursors for the biosynthesis of cuticular waxes, aliphatic suberins, and membrane lipids, including sphingolipids and phospholipids.	Arabidopsis 3-ketoacyl-coenzyme a synthase9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids.2013 · DOI: 10.1104/pp.112.210450
`At4g34510`	Active on saturated acyl-CoAs up to C22.	Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases.2006 · DOI: 10.1016/j.bbrc.2006.05.162

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024522 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0048868 pollen tube development Biological Process

GO:0160062 cutin-based cuticle development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT1G19440

ath:AT1G25450

ath:AT1G68530

ath:AT2G16280

ath:AT2G26640

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.736

Rank 1 · TkA06G135430 · TK1151

Cell membrane0.098

Rank 2 · TkA06G135430 · TK1151

Cytoplasm0.083

Rank 3 · TkA06G135430 · TK1151

Mitochondrion0.055

Rank 4 · TkA06G135430 · TK1151

Plastid0.045

Rank 5 · TkA06G135430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08392FAE1_CUT1_RppA2-241 aa

PF08541ACP_syn_III_C48-62 aa

PF00195Chal_sti_synt_N76-155 aa

PF08545ACP_syn_III95-162 aa

PF08545ACP_syn_III203-213 aa

PF08541ACP_syn_III_C259-339 aa

PF02797Chal_sti_synt_C261-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G135430	`PF08392`	FAE1_CUT1_RppA	2	241	1.4e-119	399.5
TkA06G135430	`PF08541`	ACP_syn_III_C	48	62	8.3e-14	52.2
TkA06G135430	`PF00195`	Chal_sti_synt_N	76	155	0.00084	19.6
TkA06G135430	`PF08545`	ACP_syn_III	95	162	0.1	13.3
TkA06G135430	`PF08545`	ACP_syn_III	203	213	0.1	13.3
TkA06G135430	`PF08541`	ACP_syn_III_C	259	339	8.3e-14	52.2
TkA06G135430	`PF02797`	Chal_sti_synt_C	261	332	1.6e-09	38.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XF43`	Arabidopsis thaliana	sp\|Q9XF43\|KCS6_ARATH 3-ketoacyl-CoA synthase 6	87.500%	Swiss-Prot	High
`Q9C6L5`	Arabidopsis thaliana	sp\|Q9C6L5\|KCS5_ARATH 3-ketoacyl-CoA synthase 5	84.600%	Swiss-Prot	High
`Q9LN49`	Arabidopsis thaliana	sp\|Q9LN49\|KCS4_ARATH 3-ketoacyl-CoA synthase 4	70.400%	Swiss-Prot	High
`Q9SIX1`	Arabidopsis thaliana	sp\|Q9SIX1\|KCS9_ARATH 3-ketoacyl-CoA synthase 9	71.300%	Swiss-Prot	High
`O65677`	Arabidopsis thaliana	sp\|O65677\|KCS17_ARATH 3-ketoacyl-CoA synthase 17	68.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card