TkA06G125810 | RubberDandelionOmics

Gene overview

TkA06G125810

Reference: TK1151 Chr: Chr06 Coordinates: 32911464-32913715 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1630 bp · TkA06G125810|TK1151|cDNA

GTTGCGGCGGTCTATACGGTGGCCATGGCTGCGATGCCGTGATCGGAAAACATACATCGTAAGAAGGGGATCTACTCGTTCGTTCTAACCCTAACTGCCCAAATATTATGCACCACATTTGCTGATTTCCAGTATTTTTCCGATCCGTTGCTCATCCGATCTGAAACGTATCATCCAACTACCTCTAATTTCATCCGATTAATTCGAAGAGAATTATCGAGATTGGCATGATAAATCATCAAGATGTCATTCAAAAGCAT...

CDS

Download CDS FASTA

1047 bp · TkA06G125810|TK1151|CDS

ATGGGCAAATCTCCCCCCGAACTCCTTTTGGACATAATTCGGAGAGTTGAAGAAAGCGAGACCAACTGGCCAGCAAGAACTGTTGTCGTTTATTGTGCATCTGTTTGTAAATCATGGAGAGATATCACAAAGGAAATCGTCAAAACCCCTGAAGAATGCGGAAGATTAACCTTCCCAATCTCATTAAAACAGCCTGGCCCTCGAGATCTCCCAATTCAATGCTACATAAGAAGAGACAGAGCCACTTCCACTCACCGATT...

Protein

Download Protein FASTA

348 aa · TkA06G125810|TK1151|PROTEIN

MGKSPPELLLDIIRRVEESETNWPARTVVVYCASVCKSWRDITKEIVKTPEECGRLTFPISLKQPGPRDLPIQCYIRRDRATSTHRLYFGLSPSEDESDKLLLVAKKIRRATSTEFAISLVADDFSRASSTYVGKLRSNFLGTKFTIYDSQPPTDTTSTQTNHNRPSQRFQKKQVSPKLPSCSYSIATISYELNVLRTRGPRRMNCTMHSIPISSIQEGGTAPTPKSFPLSSPSFKTLDRSTSSLSTPTPTSTDSLMLKN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G125810`
TK1151 ID	TkA06G125810
OH-1004 ID	LXL04_024593
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.851 / OH-1004 86.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G125810

Location Chr06:32911464-32913715 (+)

Description Similar to TULP5: Tubby-like F-box protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18280`	Tubby-like F-box protein 2.	No verified direct reference in this release
`At1g47270`	Tubby-like F-box protein 6.	No verified direct reference in this release
`At1g25280`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0705300`	Tubby-like F-box protein 5.	No verified direct reference in this release
`Os03g0351400`	Tubby-like F-box protein 6.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024593 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0009620 response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G47270

ath:AT2G18280

dosa:Os02g0705300

dosa:Os03g0351400

dosa:Os12g0163400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.513

Rank 1 · TkA06G125810 · TK1151

Nucleus0.401

Rank 2 · TkA06G125810 · TK1151

Cell membrane0.226

Rank 3 · TkA06G125810 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA06G125810 · TK1151

Lysosome / Vacuole0.045

Rank 5 · TkA06G125810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like5-44 aa

PF00646F-box5-44 aa

PF01167Tub62-343 aa

PF12043DUF3527130-179 aa

PF26524ARM_7257-276 aa

PF12043DUF3527306-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G125810	`PF12937`	F-box-like	5	44	0.00061	20.2
TkA06G125810	`PF00646`	F-box	5	44	0.014	16.0
TkA06G125810	`PF01167`	Tub	62	343	2.8e-102	342.5
TkA06G125810	`PF12043`	DUF3527	130	179	0.031	14.5
TkA06G125810	`PF26524`	ARM_7	257	276	0.12	12.4
TkA06G125810	`PF12043`	DUF3527	306	339	0.031	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GVE5`	Arabidopsis thaliana	sp\|Q8GVE5\|TLP2_ARATH Tubby-like F-box protein 2	63.600%	Swiss-Prot	High
`Q0WPY0`	Arabidopsis thaliana	sp\|Q0WPY0\|TLP6_ARATH Tubby-like F-box protein 6	61.600%	Swiss-Prot	High
`Q9FRH7`	Arabidopsis thaliana	sp\|Q9FRH7\|TLP10_ARATH Tubby-like F-box protein 10	57.400%	Swiss-Prot	High
`Q6Z2G9`	Oryza sativa subsp. japonica	sp\|Q6Z2G9\|TLP5_ORYSJ Tubby-like F-box protein 5	68.600%	Swiss-Prot	High
`Q10LG8`	Oryza sativa subsp. japonica	sp\|Q10LG8\|TLP6_ORYSJ Tubby-like F-box protein 6	59.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card