TkA06G124230 | RubberDandelionOmics

Gene overview

TkA06G124230

Reference: TK1151 Chr: Chr06 Coordinates: 32400058-32402802 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1930 bp · TkA06G124230|TK1151|cDNA

CTGAATGTCACTTTCTTGGTAACACAATTAAGCGGACCCAAAGCTCCAAGCTTTTCCTTGGTCGGCTCTCGCATATTACCCACAGATCATTAATCCATCTCAATCTCACCGGAAACATTTCAATTTTCAAGCTCTGCCTCTTCAGCTATTCCTACAAGTGTCCGTCTCTTTATAGCTTAGATGCGCATGACAAGACTTCAAGAAACCCTAGATCAATGCCGAGACTTGGATCATTTCAAATAGCCACAACTGCTTTCACA...

CDS

Download CDS FASTA

1431 bp · TkA06G124230|TK1151|CDS

ATGGCGAAGCAGTCCACTGGATCCTCACCATTCTTCTTCCACAAGAAGAAGCGATGGCTTCTGCTCCTGTTAGGCTTGCTATCCATCTCCACGGCGGTGGCGTTTATCATCAGGGCAGCTTTTGATTCCTCATGTGATCGCCGTCTCTTCGATGTCCCTGCTGTAGGCAAACGGTTTCAGTCGACGGTGTCGCCGCCTCCGGTCAAAGTAGCGAATCCCCTCAGTTTTATGAAGTCTAAGCTTGTCCTTCTCGTTTCTCA...

Protein

Download Protein FASTA

476 aa · TkA06G124230|TK1151|PROTEIN

MAKQSTGSSPFFFHKKKRWLLLLLGLLSISTAVAFIIRAAFDSSCDRRLFDVPAVGKRFQSTVSPPPVKVANPLSFMKSKLVLLVSHELSLSGGPLLLMELAFLLRGVGAEVCWITLQKPPGKDGVIYSLENKMLDRGVQVLSAKGEEAMNTAMKADLVVLNTAVAGKLLDGGLNKNIHQILPKVLWWIHEMRGHYFKLDYVKHLPMVAGSMIDSYVTAEYWKNRTQERLKIEMPKTYVVHLGNSKELMDVAEDNVAKRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G124230`
TK1151 ID	TkA06G124230
OH-1004 ID	LXL04_024619
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G124230`
Location	Chr06:32400058-32402802 (+)
Description	Similar to bshA: N-acetyl-alpha-D-glucosaminyl L-malate synthase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024619` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006488 dolichol-linked oligosaccharide biosynthetic process Biological Process GO:0045227 capsule polysaccharide biosynthetic process Biological Process GO:0071793 bacillithiol biosynthetic process Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0012505 endomembrane system Cellular Component GO:0000033 alpha-1,3-mannosyltransferase activity Molecular Function GO:0000166 nucleotide binding Molecular Function GO:0004378 GDP-Man:Man(1)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity Molecular Function GO:0016757 glycosyltransferase activity Molecular Function GO:0102704 GDP-Man:Man(2)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity Molecular Function
KEGG gene cross-reference	ban:BA_1558 bar:GBAA_1558 bat:BAS1445 mja:MJ_1178 ncr:NCU03503 sme:SMc01219 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.673

Rank 1 · TkA06G124230 · TK1151

Endoplasmic reticulum0.146

Rank 2 · TkA06G124230 · TK1151

Cytoplasm0.089

Rank 3 · TkA06G124230 · TK1151

Extracellular0.084

Rank 4 · TkA06G124230 · TK1151

Cell membrane0.062

Rank 5 · TkA06G124230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13524Glyco_trans_1_243-56 aa

PF16994Glyco_trans_4_578-257 aa

PF00534Glycos_transf_1121-161 aa

PF00534Glycos_transf_1263-444 aa

PF13692Glyco_trans_1_4285-428 aa

PF20706GT4-conflict286-404 aa

PF13524Glyco_trans_1_2354-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G124230	`PF13524`	Glyco_trans_1_2	43	56	0.061	14.0
TkA06G124230	`PF16994`	Glyco_trans_4_5	78	257	5.4e-67	225.4
TkA06G124230	`PF00534`	Glycos_transf_1	121	161	7.7e-21	75.1
TkA06G124230	`PF00534`	Glycos_transf_1	263	444	7.7e-21	75.1
TkA06G124230	`PF13692`	Glyco_trans_1_4	285	428	1.3e-18	68.3
TkA06G124230	`PF20706`	GT4-conflict	286	404	0.02	14.6
TkA06G124230	`PF13524`	Glyco_trans_1_2	354	459	0.061	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card