TkA06G119280 | RubberDandelionOmics

Gene overview

TkA06G119280

Reference: TK1151 Chr: Chr06 Coordinates: 31159027-31164381 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2262 bp · TkA06G119280|TK1151|cDNA

TCTCATGCTCATTTTCCCGCTCAAACCCCAAAACCCGTCTTTAATCTTCAATCCCAAAAAATCAGCGCAAATTCCCGATTTCAATGGCAGGAAATCCCGAAATCCCGAAATCAAGATCATATCTAAATTTAAATGGCTTAATACAATGATTTGCACCTATTTTATTCCTCCAACTTCATTCACCGCCATCAGATCCTCTCCATGCTCTCGGTACAATCTCCAACATAAGGCGGCTGATATGACGAGGAACACCTTGCCAT...

CDS

Download CDS FASTA

1407 bp · TkA06G119280|TK1151|CDS

ATGATGTTGACTGAATTGAGGTTTGGAGAACTTGAAGGATGTATCTTCGGTTTTGATATCGATAGAAATGGGTTGATCAAGGCGGAGTGTACAAATTCGGAATGCAGAAGGGAAATCACGTTTGTGGCCACAGAAACTCACAAGTGTAAAAAGACAACACAAATTTCTTATCCTCACATCTGCCATTGCAATTGGCTTTCCAATGTCCTCCATCCAATTCACAAATATCCACTCCCTTCACCATCGCATTTCTTCTTCAC...

Protein

Download Protein FASTA

468 aa · TkA06G119280|TK1151|PROTEIN

MMLTELRFGELEGCIFGFDIDRNGLIKAECTNSECRREITFVATETHKCKKTTQISYPHICHCNWLSNVLHPIHKYPLPSPSHFFFTHSISSLSLISLHSSFCSITMASAVSAVVSLPSSKSASISTRTSLISQERVSFTKVPYYKNVSSNGKLLSIRAQVTTEAPAKVEKVSKKQEEGVVTNKYRPKEPYVGRCLLNTKITGDDAPGETWHMVFTTEGEVPYREGQSIGVIPDGIDPKNGKPHKLRLYSIASSALGDFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G119280`
TK1151 ID	TkA06G119280
OH-1004 ID	LXL04_024665
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G119280`
Location	Chr06:31159027-31164381 (-)
Description	Similar to PETH: Ferredoxin--NADP reductase, leaf isozyme, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024665` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0015979 photosynthesis Biological Process GO:0022900 electron transport chain Biological Process GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0098807 chloroplast thylakoid membrane protein complex Cellular Component GO:0004324 ferredoxin-NADP+ reductase activity Molecular Function GO:0008266 poly(U) RNA binding Molecular Function GO:0009055 electron transfer activity Molecular Function
KEGG gene cross-reference	ag:CAA30791 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.976

Rank 1 · TkA06G119280 · TK1151

Mitochondrion0.037

Rank 2 · TkA06G119280 · TK1151

Cytoplasm0.029

Rank 3 · TkA06G119280 · TK1151

Peroxisome0.020

Rank 4 · TkA06G119280 · TK1151

Nucleus0.020

Rank 5 · TkA06G119280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00667FAD_binding_1191-234 aa

PF00970FAD_binding_6245-307 aa

PF00667FAD_binding_1246-289 aa

PF08030NAD_binding_6318-405 aa

PF00175NAD_binding_1321-435 aa

PF00880Nebulin362-374 aa

PF12965DUF3854400-442 aa

PF08030NAD_binding_6417-435 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G119280	`PF00667`	FAD_binding_1	191	234	0.071	13.4
TkA06G119280	`PF00970`	FAD_binding_6	245	307	0.0063	17.6
TkA06G119280	`PF00667`	FAD_binding_1	246	289	0.071	13.4
TkA06G119280	`PF08030`	NAD_binding_6	318	405	0.062	14.1
TkA06G119280	`PF00175`	NAD_binding_1	321	435	1e-26	94.4
TkA06G119280	`PF00880`	Nebulin	362	374	0.052	14.2
TkA06G119280	`PF12965`	DUF3854	400	442	0.08	13.6
TkA06G119280	`PF08030`	NAD_binding_6	417	435	0.062	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card