TkA06G116530 | RubberDandelionOmics

Gene overview

TkA06G116530

Reference: TK1151 Chr: Chr06 Coordinates: 30507886-30511342 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2688 bp · TkA06G116530|TK1151|cDNA

TGCAAAACAGGACTTGCCTTTGAATTTATGTGATGACAAAAGTCAAATTTCCTTCTTTTATTCTATTTTATTTCCAATATTTCCGATCCTCCTCTTCCCACTCCCGAAAGCTTCTTGCCATTTCCTCAGCTTTCATTCATTGGGCTTCGAATTGTCCATTCCTTGTAGCAGCTTTTCATCATTACCTTTTGCAAGCTTCCATCCATATCTTTATGAAACCCTAATCCCCAAATAACGGAAGGCTCCGTGTTGTTTGCTGA...

CDS

Download CDS FASTA

1917 bp · TkA06G116530|TK1151|CDS

ATGGCAACTAGTATAGCTTCTGGAAGCGCGAATTTACAATTCCGGGAGACATACTGCTGGCGACAAAGTTTTTTTTCTCCAATGGTGTCGCAGAGATGCTATAACAAATTCCCATGGTCAGATGGGGTGTCTACCAATTTTAAAATCAAGAAATACCACTACCCAATTACTGAAACTCGAAGACCCTTCCAAAGAACTATAACATCATCAATCAAAAACGAATCCACAAAGTATTTCGATTTTGCCGTTATTGGCAGCGG...

Protein

Download Protein FASTA

638 aa · TkA06G116530|TK1151|PROTEIN

MATSIASGSANLQFRETYCWRQSFFSPMVSQRCYNKFPWSDGVSTNFKIKKYHYPITETRRPFQRTITSSIKNESTKYFDFAVIGSGVAGLRYALEVAKHGTVAVITKAEPHESNTNYAQGGVSAVLCPSDSVESHMQDTIVAGAYLCDEETVRVVCTEGPERIRELIAMGASFDHGEDGNLHLAREGGHSHHRIVHAADMTGREIERALLKAIENDPSISVFKHHFAIDLLTSQNGSEMVCHGVDTIDTETRNVVRFIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G116530`
TK1151 ID	TkA06G116530
OH-1004 ID	LXL04_024703
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 99.373 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G116530

Location Chr06:30507886-30511342 (-)

Description Similar to AO: L-aspartate oxidase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14760`	Catalyzes the oxidation of L-aspartate to iminoaspartate.	Aspartate oxidase plays an important role in Arabidopsis stomatal immunity.2012 · DOI: 10.1104/pp.112.199810

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0134400`	Catalyzes the oxidation of L-aspartate to iminoaspartate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024703 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009435 NAD+ biosynthetic process Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0034628 'de novo' NAD+ biosynthetic process from L-aspartate Biological Process

GO:0042179 nicotine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0008734 L-aspartate oxidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G14760

dosa:Os02g0134400

nta:107775324

nta:107809102

rso:RSc2447

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.630

Rank 1 · TkA06G116530 · TK1151

Mitochondrion0.411

Rank 2 · TkA06G116530 · TK1151

Cytoplasm0.073

Rank 3 · TkA06G116530 · TK1151

Nucleus0.038

Rank 4 · TkA06G116530 · TK1151

Peroxisome0.021

Rank 5 · TkA06G116530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00890FAD_binding_280-464 aa

PF01266DAO80-188 aa

PF07992Pyr_redox_280-138 aa

PF03486HI0933_like80-109 aa

PF03486HI0933_like250-448 aa

PF07992Pyr_redox_2435-457 aa

PF01266DAO504-549 aa

PF02910Succ_DH_flav_C520-610 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G116530	`PF00890`	FAD_binding_2	80	464	3.8e-89	300.5
TkA06G116530	`PF01266`	DAO	80	188	5.9e-08	33.3
TkA06G116530	`PF07992`	Pyr_redox_2	80	138	0.0015	18.7
TkA06G116530	`PF03486`	HI0933_like	80	109	0.02	15.1
TkA06G116530	`PF03486`	HI0933_like	250	448	0.02	15.1
TkA06G116530	`PF07992`	Pyr_redox_2	435	457	0.0015	18.7
TkA06G116530	`PF01266`	DAO	504	549	5.9e-08	33.3
TkA06G116530	`PF02910`	Succ_DH_flav_C	520	610	3.6e-16	60.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AY1`	Arabidopsis thaliana	sp\|Q94AY1\|NADB_ARATH L-aspartate oxidase, chloroplastic	74.800%	Swiss-Prot	High
`Q6Z836`	Oryza sativa subsp. japonica	sp\|Q6Z836\|NADB_ORYSJ L-aspartate oxidase, chloroplastic	75.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card