RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G108930
Reference: TK1151 Chr: Chr06 Coordinates: 28696681-28702548 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2456 bp · TkA06G108930|TK1151|cDNA

AATGATTCTGTTTAAGACAGACCCCAAAAACCTTCCAACACTCACATATTCTCAGTCTCTCTCTTTCTGTACGTGTATACTATACTCTTGGGTTATCATTCACACAATTCAGATTCAATCTTCCAATTATCATCAATTTTCCAGATCACATTTCGATAATTGTTAACGATGATGGAGCGATCGTCATCGAGACGAGATGTGGCGAGCAGTTACGATGATGATATGCCACACAGCGAGAGCGATAAAAGGAGCAAGGAGGC...

CDS

Download CDS FASTA

2100 bp · TkA06G108930|TK1151|CDS

ATGATGGAGCGATCGTCATCGAGACGAGATGTGGCGAGCAGTTACGATGATGATATGCCACACAGCGAGAGCGATAAAAGGAGCAAGGAGGCGGCGGAGATGGATACGATCGAGAGGATATTCGAGAGCAAGGAGGTGCCGCCATGGCAGAAGCAGCTGACGGTGCGAGCATTTGCTGTGAGCTTTGTTTTGGGGATTATGTTTACCTTCATTGTTATGAAACTTAACCTGACTACCGGAATTATTCCGTCGCTTAACGT...

Protein

Download Protein FASTA

699 aa · TkA06G108930|TK1151|PROTEIN

MMERSSSRRDVASSYDDDMPHSESDKRSKEAAEMDTIERIFESKEVPPWQKQLTVRAFAVSFVLGIMFTFIVMKLNLTTGIIPSLNVSAGLLGFFFVKTWTKFLNKSGMLRQPFTRQENTVIQTCVVATSGIAFSGGFGSYLFGMSEVVAKQSSENNYTENIKNPTLTWLIGFLFVVSFLGLFSVVPLRKIMIVDFKLIYPSGTATAHLINSFHTPQGAKLAKRQVRTLGKFFTFSFLWGVFQWFFTAGDGCGFSSFPSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G108930
TK1151 IDTkA06G108930
OH-1004 IDLXL04_024782
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)74.400
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G108930
LocationChr06:28696681-28702548 (-)
DescriptionSimilar to YSL7: Probable metal-nicotianamine transporter YSL7
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g65730 May be involved in the transport of nicotianamine-chelated metals. No verified direct reference in this release
At3g17650 May be involved in the transport of nicotianamine-chelated metals. No verified direct reference in this release
At1g48370 May be involved in the transport of nicotianamine-chelated metals. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0524600 May be involved in the transport of nicotianamine-chelated metals. No verified direct reference in this release
Os02g0633300 May be involved in the transport of nicotianamine-chelated metals. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_024782 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0005634 nucleus Cellular Component
GO:0016020 membrane Cellular Component
GO:0035673 oligopeptide transmembrane transporter activity Molecular Function
KEGG gene cross-reference
ath:AT1G65730
dosa:Os04g0524600
dosa:Os04g0674600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.497
Rank 1 · TkA06G108930 · TK1151
Lysosome / Vacuole0.250
Rank 2 · TkA06G108930 · TK1151
Endoplasmic reticulum0.134
Rank 3 · TkA06G108930 · TK1151
Cytoplasm0.077
Rank 4 · TkA06G108930 · TK1151
Golgi apparatus0.063
Rank 5 · TkA06G108930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03169OPT52-671 aa
PF02687FtsX57-92 aa
PF02687FtsX120-192 aa
PF02687FtsX290-305 aa
PF08404Baculo_p74_N330-378 aa
PF02687FtsX406-419 aa
PF02687FtsX522-539 aa
PF02687FtsX603-636 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G108930PF03169OPT526715.4e-168561.2
TkA06G108930PF02687FtsX57920.008816.8
TkA06G108930PF02687FtsX1201920.008816.8
TkA06G108930PF02687FtsX2903050.008816.8
TkA06G108930PF08404Baculo_p74_N3303780.1711.7
TkA06G108930PF02687FtsX4064190.008816.8
TkA06G108930PF02687FtsX5225390.008816.8
TkA06G108930PF02687FtsX6036360.008816.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SHY2Arabidopsis thalianasp|Q9SHY2|YSL7_ARATH Probable metal-nicotianamine transporter YSL776.300%Swiss-ProtHigh
Q9LUN2Arabidopsis thalianasp|Q9LUN2|YSL5_ARATH Probable metal-nicotianamine transporter YSL571.300%Swiss-ProtHigh
Q6R3K4Arabidopsis thalianasp|Q6R3K4|YSL8_ARATH Probable metal-nicotianamine transporter YSL872.500%Swiss-ProtHigh
Q5JQD7Oryza sativa subsp. japonicasp|Q5JQD7|YSL12_ORYSJ Probable metal-nicotianamine transporter YSL1273.000%Swiss-ProtHigh
Q6H7J6Oryza sativa subsp. japonicasp|Q6H7J6|YSL14_ORYSJ Probable metal-nicotianamine transporter YSL1471.400%Swiss-ProtHigh

JBrowse

View in Genome Browser