TkA06G104110 | RubberDandelionOmics

Gene overview

TkA06G104110

Reference: TK1151 Chr: Chr06 Coordinates: 27610324-27613383 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

987 bp · TkA06G104110|TK1151|cDNA

ATGAAACTAAACACAAATGGGCAGTCATGGTGGTCGATGGCCACCATACTGGTTATCCTTTTCATCTCATTGGCACAACCAGTGACATCACAGAAGATCGATAAAAACAACACAATGATCAGATGGTATTGTAGTAGCTACAAAGGTATGAATGGCCAAGTTTTTCTCGAAAACCTCAACACCACCTTTTCAAGCCTCAGAAAACAGTTATCCAAAGTCAACAATCACCATGCAGTTTCCAATACCGTGATTAATGGCGA...

CDS

Download CDS FASTA

987 bp · TkA06G104110|TK1151|CDS

ATGAAACTAAACACAAATGGGCAGTCATGGTGGTCGATGGCCACCATACTGGTTATCCTTTTCATCTCATTGGCACAACCAGTGACATCACAGAAGATCGATAAAAACAACACAATGATCAGATGGTATTGTAGTAGCTACAAAGGTATGAATGGCCAAGTTTTTCTCGAAAACCTCAACACCACCTTTTCAAGCCTCAGAAAACAGTTATCCAAAGTCAACAATCACCATGCAGTTTCCAATACCGTGATTAATGGCGA...

Protein

Download Protein FASTA

328 aa · TkA06G104110|TK1151|PROTEIN

MKLNTNGQSWWSMATILVILFISLAQPVTSQKIDKNNTMIRWYCSSYKGMNGQVFLENLNTTFSSLRKQLSKVNNHHAVSNTVINGESVFGLALCREYLSIAACLSCFDTAVSYMKVCGLGNGANIFYDNCQIRYENRNFYNDAIVKTSIAICGNKTSTYPKEMKKIASGLLSDLQIATPKTFNFFAASTRKITGTNATVYAVAQCVRNISQNYHSCVELPCSKDIQEVWGKSTGATDMLQRTTVYTYKDLKMATNNFSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G104110`
TK1151 ID	TkA06G104110
OH-1004 ID	LXL04_024832
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	51.200
Protein coverage (%)	TK1151 99.390 / OH-1004 94.523 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G104110`
Location	Chr06:27610324-27613383 (+)
Description	Similar to CRK2: Cysteine-rich receptor-like protein kinase 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_024832` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006468 protein phosphorylation Biological Process GO:0007165 signal transduction Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0009737 response to abscisic acid Biological Process GO:0010193 response to ozone Biological Process GO:0042742 defense response to bacterium Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0052545 callose localization Biological Process GO:0072593 reactive oxygen species metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005773 vacuole Cellular Component
KEGG gene cross-reference	ath:AT1G19090 ath:AT1G70520 ath:AT1G70530 ath:AT4G21410 ath:AT5G40380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.745

Rank 1 · TkA06G104110 · TK1151

Extracellular0.113

Rank 2 · TkA06G104110 · TK1151

Endoplasmic reticulum0.077

Rank 3 · TkA06G104110 · TK1151

Cytoplasm0.077

Rank 4 · TkA06G104110 · TK1151

Nucleus0.034

Rank 5 · TkA06G104110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21894N4_RNAP_helical33-78 aa

PF01657Stress-antifung44-138 aa

PF07315DUF146262-92 aa

PF02663FmdE97-171 aa

PF01657Stress-antifung155-229 aa

PF21894N4_RNAP_helical167-245 aa

PF07315DUF1462215-261 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G104110	`PF21894`	N4_RNAP_helical	33	78	0.042	14.5
TkA06G104110	`PF01657`	Stress-antifung	44	138	8.7e-19	68.7
TkA06G104110	`PF07315`	DUF1462	62	92	0.077	14.0
TkA06G104110	`PF02663`	FmdE	97	171	0.12	13.1
TkA06G104110	`PF01657`	Stress-antifung	155	229	8.7e-19	68.7
TkA06G104110	`PF21894`	N4_RNAP_helical	167	245	0.042	14.5
TkA06G104110	`PF07315`	DUF1462	215	261	0.077	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card