TkA06G097600 | RubberDandelionOmics

Gene overview

TkA06G097600

Reference: TK1151 Chr: Chr06 Coordinates: 25985004-25989410 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2544 bp · TkA06G097600|TK1151|cDNA

ATGGTGAACTTCCACAGTAGAAGAGGCGGAGCTTCGTACGCCGAGGTGACCACAGGGAAAAGACCGGAGCAATCTCATACTAAAAAGGAGGAAAATTCGATTAAGCCAAGGAAATCGACCCCTCCCCTGTCCTTAGTTTCTAACCCAGCGGACATAAAGGCCCTCCGCTGCAAGCTGATAGGAGAGGTAACAAACTACCACGCCCTTCATAGTGTGGTAAACGTGTTCCTGGGAGAAGGCTATGGCAAGAATACCCTGGA...

CDS

Download CDS FASTA

2544 bp · TkA06G097600|TK1151|CDS

ATGGTGAACTTCCACAGTAGAAGAGGCGGAGCTTCGTACGCCGAGGTGACCACAGGGAAAAGACCGGAGCAATCTCATACTAAAAAGGAGGAAAATTCGATTAAGCCAAGGAAATCGACCCCTCCCCTGTCCTTAGTTTCTAACCCAGCGGACATAAAGGCCCTCCGCTGCAAGCTGATAGGAGAGGTAACAAACTACCACGCCCTTCATAGTGTGGTAAACGTGTTCCTGGGAGAAGGCTATGGCAAGAATACCCTGGA...

Protein

Download Protein FASTA

847 aa · TkA06G097600|TK1151|PROTEIN

MVNFHSRRGGASYAEVTTGKRPEQSHTKKEENSIKPRKSTPPLSLVSNPADIKALRCKLIGEVTNYHALHSVVNVFLGEGYGKNTLDYLGGLWVLINVQSQEEKDKLMVNKNLRTWFKELKSWDPNFQIQDRITWLQIDGIPLQVWNMENMIKIGRLWGEVIVTDPCIFGGRSVNKGKICISTPIKDIITESRTIKVDGLDVIIRIREVAEDVDPISESADEEGNSTANSDEEFFSEEEEEDMSDAGNCPSEQFSDQDFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G097600`
TK1151 ID	TkA06G097600
OH-1004 ID	LXL04_001933
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	62.500
Protein coverage (%)	TK1151 44.038 / OH-1004 26.493 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G097600

Location Chr06:25985004-25989410 (-)

Description Similar to At1g65750: Putative ribonuclease H protein At1g65750

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65750`	Putative ribonuclease H protein At1g65750.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001933 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003824 catalytic activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.561

Rank 1 · TkA06G097600 · TK1151

Cytoplasm0.401

Rank 2 · TkA06G097600 · TK1151

Cell membrane0.086

Rank 3 · TkA06G097600 · TK1151

Mitochondrion0.027

Rank 4 · TkA06G097600 · TK1151

Endoplasmic reticulum0.024

Rank 5 · TkA06G097600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20181DUF654495-140 aa

PF13966zf-RVT658-684 aa

PF13966zf-RVT793-845 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G097600	`PF20181`	DUF6544	95	140	0.12	12.3
TkA06G097600	`PF13966`	zf-RVT	658	684	3e-05	25.3
TkA06G097600	`PF13966`	zf-RVT	793	845	3e-05	25.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C2F6`	Arabidopsis thaliana	sp\|P0C2F6\|RNHX1_ARATH Putative ribonuclease H protein At1g65750	25.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card