TkA06G094320 | RubberDandelionOmics

Gene overview

TkA06G094320

Reference: TK1151 Chr: Chr06 Coordinates: 25075458-25078253 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1963 bp · TkA06G094320|TK1151|cDNA

GAAAACTGGGGAAGAGAGGTGCGTTTACGCAATTGGGATGACTGTATTTTCTGCTGGTGTATCGGGAGACTAAAATGCTCAAACTTGGGGGAAAGAGAGTGTGAGTGATAGGGTCAGAATGCAATAATGACAAAACTTCTGACGATGGACTATTATTTTGGGTGTAATTGGAAAAGGCTACCGTACTACTACTGATTCGCTATCTTCTCATACCAGTAAAAAAGATCATTTCTTTTAACTTCCAAAGATTTTCCATTTTC...

CDS

Download CDS FASTA

1422 bp · TkA06G094320|TK1151|CDS

ATGCAAAGCTTTAGAACTACACCACCGCCTGCTGCCGCTGCCCATCCTCTTTCGTCTTCGGACTTGTATTGCCATTCTCCATATTACATTAGAGCAGATGAAAATGGAAGAACGGATACGCGTTTTACGGATCTTGGTGAGCTTCAACACTCAGCTGCTTTTCATAACGAGGATGCTGTTGATTTAAGCAGAAGTTCGATATATAATGAAATAAAAGCAGGAAATGGAGTTGTTCTCGCTAATAGCTTACAGTTTCCGCC...

Protein

Download Protein FASTA

473 aa · TkA06G094320|TK1151|PROTEIN

MQSFRTTPPPAAAAHPLSSSDLYCHSPYYIRADENGRTDTRFTDLGELQHSAAFHNEDAVDLSRSSIYNEIKAGNGVVLANSLQFPPHHMNFGSTTEMSSIGTGVDTGQYMMQHHKTMVASGGRSGGGGGGGGGGGMGKGHFENWGESGIADNSQQTDTSTDIDTDDKNQYNSLQHGGQVAVDSMEGSMGKIGDQKILRRLAQNREAARKSRLRKKAYVQQLESSRLKLTQLEQELKRARQQGMFASGGDQTHLVGGSGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G094320`
TK1151 ID	TkA06G094320
OH-1004 ID	LXL04_024950
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G094320

Location Chr06:25075458-25078253 (-)

Description Similar to Transcription factor HBP-1b(c1) (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68640`	Transcriptional activator involved in the determination of floral organ number.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0808100`	Transcriptional regulator involved in defense response.	No verified direct reference in this release
`Os03g0318600`	Transcriptional regulator involved in defense response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024950 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

dosa:Os03g0318600

nta:107782457

osa:4332660

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.893

Rank 1 · TkA06G094320 · TK1151

Cytoplasm0.163

Rank 2 · TkA06G094320 · TK1151

Cell membrane0.038

Rank 3 · TkA06G094320 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA06G094320 · TK1151

Mitochondrion0.016

Rank 5 · TkA06G094320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00170bZIP_1196-237 aa

PF07716bZIP_2196-237 aa

PF01481Arteri_nucleo196-279 aa

PF03131bZIP_Maf196-242 aa

PF28673bZIP_CREBRF_C200-238 aa

PF14144DOG1278-351 aa

PF01481Arteri_nucleo430-447 aa

PF03131bZIP_Maf431-439 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G094320	`PF00170`	bZIP_1	196	237	9.6e-07	29.5
TkA06G094320	`PF07716`	bZIP_2	196	237	2.7e-05	24.8
TkA06G094320	`PF01481`	Arteri_nucleo	196	279	0.036	15.1
TkA06G094320	`PF03131`	bZIP_Maf	196	242	0.045	15.0
TkA06G094320	`PF28673`	bZIP_CREBRF_C	200	238	0.11	13.6
TkA06G094320	`PF14144`	DOG1	278	351	3.8e-32	111.0
TkA06G094320	`PF01481`	Arteri_nucleo	430	447	0.036	15.1
TkA06G094320	`PF03131`	bZIP_Maf	431	439	0.045	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX27`	Arabidopsis thaliana	sp\|Q9SX27\|PAN_ARATH Transcription factor PERIANTHIA	55.600%	Swiss-Prot	High
`Q6IVC2`	Oryza sativa subsp. japonica	sp\|Q6IVC2\|TGAL1_ORYSJ Transcription factor TGAL1	59.400%	Swiss-Prot	High
`Q6IVC3`	Oryza sativa subsp. japonica	sp\|Q6IVC3\|TGA22_ORYSJ Transcription factor TGA2.2	70.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card