TkA06G090930 | RubberDandelionOmics

Gene overview

TkA06G090930

Reference: TK1151 Chr: Chr06 Coordinates: 24209833-24211306 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1171 bp · TkA06G090930|TK1151|cDNA

AAGACTTCTTAGTAGTTCCCATTTGGCTTCTACTTGTATCACTTAAAGGCAATATTTTATAGGGTGTACTTCCCTATATATTTTTTCTTTTAACTTTTTCAAGAAACCTCTTTTGGCTATGGGAATCACTATCATATCATCAATGAGGGCGGCTAAGAACATGAATCATGAAGAAGAGTTTGATCAGCTAAAAAGAGGGCCATGGACACTTGAGGAAGACAATCTTCTTATCCGTTATATCAATTGCCATGGTGAAGGTC...

CDS

Download CDS FASTA

606 bp · TkA06G090930|TK1151|CDS

ATGTTCTTAAGATTCTCTTTAATGTTTGACTACCAGATGGTCAAAAATCGCCAACACTTGCCGGGAAGAACAGACAATGAGATCAAGAATTACTGGCGAACAAGAGTACAGAAACAAGCTCGCCACCTTAAAATCGACTGTAGTAGTAAGAGATTTGTAGACGCACTTCATCGATTTTGGATGCCAAGGTTGCTTGAGAAAGTAGAGCAAACCTCATCGTCATCATCATCAACATCAACTGCTTCCATTTCCACCATGAA...

Protein

Download Protein FASTA

201 aa · TkA06G090930|TK1151|PROTEIN

MFLRFSLMFDYQMVKNRQHLPGRTDNEIKNYWRTRVQKQARHLKIDCSSKRFVDALHRFWMPRLLEKVEQTSSSSSSTSTASISTMKTEQNKLSPNSQSDQTIIAESSTNSRSSIDRSSDSSGKMLPQLPEMTTQLYGDTAFDDSLIQHHDCYNVDIGGLEMMGYGQPDDMSSLNFQKADTDWITGGDMEGDTYWNMDEFW

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G090930`
TK1151 ID	TkA06G090930
OH-1004 ID	LXL04_024981
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 91.045 / OH-1004 51.549 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G090930

Location Chr06:24209833-24211306 (-)

Description Similar to MYB62: Transcription factor MYB62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68320`	Transcription repressor of phosphate (Pi) starvation-induced genes.	Phosphate starvation responses and gibberellic acid biosynthesis are regulated by the MYB62 transcription factor in Arabidopsis.2009 · DOI: 10.1093/mp/ssn081
`At3g06490`	Transcription factor contributing to the regulation of stamen maturation and male fertility in response to jasmonate signaling.	The BOTRYTIS SUSCEPTIBLE1 gene encodes an R2R3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis.2003 · DOI: 10.1105/tpc.014167 MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis.2009 · DOI: 10.1104/pp.108.132597 The Arabidopsis Botrytis Susceptible1 Interactor defines a subclass of RING E3 ligases that regulate pathogen and stress responses.2010 · DOI: 10.1104/pp.110.163915 Regulation of ABA dependent wound induced spreading cell death by MYB108.2013 · DOI: 10.1111/nph.12456
`At5g49620`	Transcription factor MYB78.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0684000`	Jasmonate- (JA-) responsive transcription factor that promotes AGO18, AGO1a and AGO1b expression by binding to AG-motif-like elements in their promoters.	A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death.2001 · DOI: 10.1094/mpmi.2001.14.4.527 Jasmonate Signaling Enhances RNA Silencing and Antiviral Defense in Rice.2020 · DOI: 10.1016/j.chom.2020.05.001
`Os03g0315400`	Transcription factor involved in abiotic stress responses.	A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice.2012 · DOI: 10.1093/jxb/err431

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024981 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009620 response to fungus Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010015 root morphogenesis Biological Process

GO:0010373 negative regulation of gibberellin biosynthetic process Biological Process

GO:0012501 programmed cell death Biological Process

KEGG gene cross-reference

ath:AT1G68320

ath:AT3G06490

ath:AT5G49620

dosa:Os03g0315400

dosa:Os11g0684000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946

Rank 1 · TkA06G090930 · TK1151

Cytoplasm0.204

Rank 2 · TkA06G090930 · TK1151

Mitochondrion0.023

Rank 3 · TkA06G090930 · TK1151

Cell membrane0.018

Rank 4 · TkA06G090930 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA06G090930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding18-34 aa

PF15748CCSAP49-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G090930	`PF00249`	Myb_DNA-binding	18	34	0.00036	21.3
TkA06G090930	`PF15748`	CCSAP	49	133	0.07	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9G7`	Arabidopsis thaliana	sp\|Q9C9G7\|MYB62_ARATH Transcription factor MYB62	70.900%	Swiss-Prot	Low
`Q9LDE1`	Arabidopsis thaliana	sp\|Q9LDE1\|MY108_ARATH Transcription factor MYB108	60.700%	Swiss-Prot	Low
`Q9FGY3`	Arabidopsis thaliana	sp\|Q9FGY3\|MYB78_ARATH Transcription factor MYB78	61.800%	Swiss-Prot	Low
`Q2QZJ8`	Oryza sativa subsp. japonica	sp\|Q2QZJ8\|JAMYB_ORYSJ Transcription factor JAMYB	70.600%	Swiss-Prot	Low
`Q10MB4`	Oryza sativa subsp. japonica	sp\|Q10MB4\|MYB2_ORYSJ Transcription factor MYB2	65.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card