TkA06G086980 | RubberDandelionOmics

Gene overview

TkA06G086980

Reference: TK1151 Chr: Chr06 Coordinates: 23232806-23234595 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1315 bp · TkA06G086980|TK1151|cDNA

CCAAACATTAAATTCCTTTCTTGTTTTCATCGTACGACCAATTTCTATAAAAACCGTCTAATACCCTTTTCTACTTTCCAAATGGTCTCTTCTAATATCATTCCAGAATGACCACTTTCTCTCCGTCTTACGTAACCAGCTTCAAAACAAACACGTTGACTAGAGAAAGTGGTGTCGGTTGGCGGAGGATATGTGGCTTAAAGATCAACGGACCTTCAGTCGCCATGATACGTGGCCGGACCACCATGACCGCCGCCCCG...

CDS

Download CDS FASTA

1176 bp · TkA06G086980|TK1151|CDS

ATGACCACTTTCTCTCCGTCTTACGTAACCAGCTTCAAAACAAACACGTTGACTAGAGAAAGTGGTGTCGGTTGGCGGAGGATATGTGGCTTAAAGATCAACGGACCTTCAGTCGCCATGATACGTGGCCGGACCACCATGACCGCCGCCCCGATGGCCGGTGTGAATGGAAAGGTGCTTGTGGAGAGGACGATTATACCGACTAAAAAGCAGTTCGTTGACCCTTTTCGACAAGGAGTAATAATCTTGGATGGGGTCGG...

Protein

Download Protein FASTA

391 aa · TkA06G086980|TK1151|PROTEIN

MTTFSPSYVTSFKTNTLTRESGVGWRRICGLKINGPSVAMIRGRTTMTAAPMAGVNGKVLVERTIIPTKKQFVDPFRQGVIILDGVGYRQTVVVRSYEVGTDKTVTPQSILNLLQETALNHVWMSGLLGDGFGATHGMMKNNLIWVVSRMQVQLDQYPIWGEILEIDTWVRASGKNGMRRDWEIRSHTTGIVFARATSTWVMMNQTTRRLSKMPDEVRAEISPWFIKKQAIKEDSPEKINKLDDNAKYVNSGLQPKRSDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G086980`
TK1151 ID	TkA06G086980
OH-1004 ID	LXL04_025026
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G086980

Location Chr06:23232806-23234595 (+)

Description Similar to FATB: Palmitoyl-acyl carrier protein thioesterase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08510`	Plays an essential role in chain termination during de novo fatty acid synthesis.	Accumulation of palmitate in Arabidopsis mediated by the acyl-acyl carrier protein thioesterase FATB1.2000 · DOI: 10.1104/pp.123.2.637 Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases.2002 · DOI: 10.1016/s0003-9861(02)00017-6 Disruption of the FATB gene in Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth.2003 · DOI: 10.1105/tpc.008946 A structural model of the plant acyl-acyl carrier protein thioesterase FatB comprises two helix/4-stranded sheet domains, the N-terminal domain containing residues that affect specificity and the C-terminal domain containing catalytic residues.2005 · DOI: 10.1074/jbc.m411351200 A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis.2008 · DOI: 10.1105/tpc.107.054858

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025026 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0000036 acyl carrier activity Molecular Function

GO:0016297 fatty acyl-[ACP] hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G08510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.869

Rank 1 · TkA06G086980 · TK1151

Mitochondrion0.167

Rank 2 · TkA06G086980 · TK1151

Cytoplasm0.035

Rank 3 · TkA06G086980 · TK1151

Nucleus0.026

Rank 4 · TkA06G086980 · TK1151

Peroxisome0.022

Rank 5 · TkA06G086980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01643Acyl-ACP_TE87-221 aa

PF15113TMEM117144-213 aa

PF132794HBT_2160-220 aa

PF20791Acyl-ACP_TE_C162-200 aa

PF20791Acyl-ACP_TE_C246-337 aa

PF132794HBT_2258-279 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G086980	`PF01643`	Acyl-ACP_TE	87	221	4.6e-34	117.7
TkA06G086980	`PF15113`	TMEM117	144	213	0.37	10.4
TkA06G086980	`PF13279`	4HBT_2	160	220	1.6e-08	35.8
TkA06G086980	`PF20791`	Acyl-ACP_TE_C	162	200	1.3e-22	80.6
TkA06G086980	`PF20791`	Acyl-ACP_TE_C	246	337	1.3e-22	80.6
TkA06G086980	`PF13279`	4HBT_2	258	279	1.6e-08	35.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJE2`	Arabidopsis thaliana	sp\|Q9SJE2\|FATB_ARATH Palmitoyl-acyl carrier protein thioesterase, chloroplastic	47.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card