RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G085880
Reference: TK1151 Chr: Chr06 Coordinates: 22984546-22988248 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2085 bp · TkA06G085880|TK1151|cDNA

TTCTTTTCTTACAATAACCTTTAAATCTTTAATCACCCAAAGAAAAAGGTTAAAGTGTTTCAATGGTAACGTATTTTGCACAATTTATTTCATCAAAACATCTTCCCTTGGAGTCTTTGCCAGACTTCCCATTTTCAATCGGAAGCAGCGCAGTACGCACCTCTCTCCGCCGGTCAGCCTAATTCTCCGTAACAGCTCTGCGATCTTTCTTCAACCTCCGTTCTCCATCCATGTCTTCATTTTTTAGGCTTTTGACGGCG...

CDS

Download CDS FASTA

1548 bp · TkA06G085880|TK1151|CDS

ATGTCTTCATTTTTTAGGCTTTTGACGGCGCCCCTGCTTCTCTGGACCTTCTTATCACTATCCTTGTTCTCCTCGGCTTCGCTGATTCATTATGCGGCGGGATCTCGATGGCTCCTACGTGCGGTTAACAGTGGTGGAAATCAACCTGATTTCGCTGTTGATTTGAACGCCACCAACTTCGATGGAGTTCTCAAGGACACCCCTGCTACTTTCGCCATTGTGGAGTTCTTCGCTCACTGGTGTCCAGCTTGCAGAAATTA...

Protein

Download Protein FASTA

515 aa · TkA06G085880|TK1151|PROTEIN

MSSFFRLLTAPLLLWTFLSLSLFSSASLIHYAAGSRWLLRAVNSGGNQPDFAVDLNATNFDGVLKDTPATFAIVEFFAHWCPACRNYKPQYEKVARLFNGPNAVHPGIILMTRVDCANKINTKLCDKFSITHYPSLFWAPPSKFVGGSWNGKNEKSEIRSIEDGRTSDRLLKWINTQLGSSYTLEDEKYENDESIQSNVSDPGQIARAIYDVEEATSHAFDIILQHKMIKPDTRVTLIKFMQLMAVHHPSKRCRRGTADV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G085880
TK1151 IDTkA06G085880
OH-1004 IDLXL04_021268
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)62.600
Protein coverage (%)TK1151 98.641 / OH-1004 95.104
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G085880
LocationChr06:22984546-22988248 (-)
DescriptionSimilar to QSOX1: Sulfhydryl oxidase 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g01270 Catalyzes the oxidation of sulfhydryl groups in peptide and protein thiols to disulfides with the reduction of oxygen to hydrogen peroxide. No verified direct reference in this release
At1g15020 Sulfhydryl oxidase involved in the regulation of cation homeostasis.
An Arabidopsis quiescin-sulfhydryl oxidase regulates cation homeostasis at the root symplast-xylem interface.2007 · DOI: 10.1038/sj.emboj.7601757

Rice

Reference gene IDPossible functionPapers / DOI
Os05g0552500 Catalyzes the oxidation of sulfhydryl groups in peptide and protein thiols to disulfides with the reduction of oxygen to hydrogen peroxide. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_021268 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006457 protein folding Biological Process
GO:0043157 response to cation stress Biological Process
GO:0043268 positive regulation of potassium ion transport Biological Process
GO:0000137 Golgi cis cisterna Cellular Component
GO:0000138 Golgi trans cisterna Cellular Component
GO:0000139 Golgi membrane Cellular Component
GO:0005576 extracellular region Cellular Component
GO:0005615 extracellular space Cellular Component
GO:0005768 endosome Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0005802 trans-Golgi network Cellular Component
GO:0003756 protein disulfide isomerase activity Molecular Function
KEGG gene cross-reference
ath:AT1G15020
ath:AT2G01270
dosa:Os05g0552500
gga:373914
xla:447270
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.446
Rank 1 · TkA06G085880 · TK1151
Endoplasmic reticulum0.299
Rank 2 · TkA06G085880 · TK1151
Cytoplasm0.120
Rank 3 · TkA06G085880 · TK1151
Lysosome / Vacuole0.095
Rank 4 · TkA06G085880 · TK1151
Cell membrane0.077
Rank 5 · TkA06G085880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00578AhpC-TSA49-110 aa
PF04756OST3_OST651-185 aa
PF00085Thioredoxin54-160 aa
PF29481SKG1163-201 aa
PF04777Evr1_Alr234-256 aa
PF00628PHD294-309 aa
PF04777Evr1_Alr319-406 aa
PF00628PHD349-370 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G085880PF00578AhpC-TSA491100.05814.0
TkA06G085880PF04756OST3_OST6511851.9e-0628.2
TkA06G085880PF00085Thioredoxin541603.2e-1350.3
TkA06G085880PF29481SKG11632010.7910.3
TkA06G085880PF04777Evr1_Alr2342562.3e-2176.7
TkA06G085880PF00628PHD2943094.28.2
TkA06G085880PF04777Evr1_Alr3194062.3e-2176.7
TkA06G085880PF00628PHD3493704.28.2
TkA06G085880PF26833Phage_Mu_gp63503650.1612.8
TkA06G085880PF26833Phage_Mu_gp63784230.1612.8
TkA06G085880PF00628PHD4154214.28.2
TkA06G085880PF29481SKG14785090.7910.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9ZU40Arabidopsis thalianasp|Q9ZU40|QSOX2_ARATH Sulfhydryl oxidase 261.600%Swiss-ProtHigh
Q8W4J3Arabidopsis thalianasp|Q8W4J3|QSOX1_ARATH Sulfhydryl oxidase 158.900%Swiss-ProtHigh
Q6AUC6Oryza sativa subsp. japonicasp|Q6AUC6|QSOX1_ORYSJ Sulfhydryl oxidase 155.800%Swiss-ProtHigh

JBrowse

View in Genome Browser