TkA06G085860 | RubberDandelionOmics

Gene overview

TkA06G085860

Reference: TK1151 Chr: Chr06 Coordinates: 22976549-22980839 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3255 bp · TkA06G085860|TK1151|cDNA

ATTTGCTTTCTTTTCTTTTCAGCAATAGCATCCCAATGGCGTTTAAATTTGATTTTCCACCAGATCAAAGTCATAGTACCAACAAACGATGGTTGATTTGAATTACAAATATTACAAATTCAAACCCATCAGAGGGAGGCGACACATAAGAAGAAATCTCACATGTCCTGATTTTGCTGGAAATGTGGGATGAAGAAAGGAAGTGGTGGTCGACGTGAGACCGGAGAGTTGGTGGTGGCCGGAGACGGAGGTGGTGACTA...

CDS

Download CDS FASTA

1671 bp · TkA06G085860|TK1151|CDS

ATGGGGAAGCAATCCGTGCTGGTTTCGTTCTTCGTCGTCTTCATCAGCTCTGTTTCGTGTACTTCTTCACTCTCAGATGATCATTCCAAGTTTATACTAGGGAAAGATAACTTCGGCCATTGGAGAAACGGGATCTTAAGCTCAACACCTGCAAATTTAGCTCCTTCTCCCTCCAACGATCCATCCAGCACACTCGTATTAGCAGGATCAAGAACAAAAAGACCCGACATTCTCAACAATTTCAAACGCTATCACGACGG...

Protein

Download Protein FASTA

556 aa · TkA06G085860|TK1151|PROTEIN

MGKQSVLVSFFVVFISSVSCTSSLSDDHSKFILGKDNFGHWRNGILSSTPANLAPSPSNDPSSTLVLAGSRTKRPDILNNFKRYHDGWDITNKHYWASVGFTGVAAFTLAILWFVSFGLAMIIHHCCGWRIDIKGNESSGSQRICLILLIVFTCGSSIGCILLSVGQDQFHGKAMETLNFVVNQSDYTVQTLVNVTEYMSLAKTVNVAEVFLPSDVKDDIDRLNIDLNNAANTLKLKTNQNSHTITTVFDAVRLSMIAVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G085860`
TK1151 ID	TkA06G085860
OH-1004 ID	LXL04_025043
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G085860`
Location	Chr06:22976549-22980839 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025043` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.508

Rank 1 · TkA06G085860 · TK1151

Lysosome / Vacuole0.301

Rank 2 · TkA06G085860 · TK1151

Cytoplasm0.139

Rank 3 · TkA06G085860 · TK1151

Endoplasmic reticulum0.100

Rank 4 · TkA06G085860 · TK1151

Golgi apparatus0.066

Rank 5 · TkA06G085860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04906Tweety80-334 aa

PF20990DUF2207_C90-154 aa

PF20237DUF659494-157 aa

PF00335Tetraspanin114-184 aa

PF29008DDB_G0292058_C147-435 aa

PF20990DUF2207_C209-304 aa

PF00335Tetraspanin238-310 aa

PF20237DUF6594242-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G085860	`PF04906`	Tweety	80	334	0.033	13.6
TkA06G085860	`PF20990`	DUF2207_C	90	154	1.9	8.8
TkA06G085860	`PF20237`	DUF6594	94	157	0.49	11.0
TkA06G085860	`PF00335`	Tetraspanin	114	184	0.0013	19.2
TkA06G085860	`PF29008`	DDB_G0292058_C	147	435	2.1e-05	24.3
TkA06G085860	`PF20990`	DUF2207_C	209	304	1.9	8.8
TkA06G085860	`PF00335`	Tetraspanin	238	310	0.0013	19.2
TkA06G085860	`PF20237`	DUF6594	242	297	0.49	11.0
TkA06G085860	`PF29008`	DDB_G0292058_C	426	503	2.1e-05	24.3
TkA06G085860	`PF20990`	DUF2207_C	472	515	1.9	8.8
TkA06G085860	`PF20237`	DUF6594	488	518	0.49	11.0
TkA06G085860	`PF00335`	Tetraspanin	497	507	0.0013	19.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card