TkA06G078550 | RubberDandelionOmics

Gene overview

TkA06G078550

Reference: TK1151 Chr: Chr06 Coordinates: 21071114-21073323 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1658 bp · TkA06G078550|TK1151|cDNA

GGTTTTTAACCACCAATAACGAGAACAGAACCAGCCATGGCTACTTTCTTCCCTACCTTCTCCACTCCAAACCTTCTTAGATCCAAATCAGTTCTCCATTACAGCCAACGACTCAACGTCAAGTGCAACGCGGCACCGCCACCGTCACTTCCACCGGCAGTCCAGACATTCTGGAAATGGTTCTGTGACGAAAAGATAGTTTCGTCCAAGTCTCCAGCGAAGCCCGGAATCGTCACGGAAGGTCTAGGACTGGTTGCGCA...

CDS

Download CDS FASTA

753 bp · TkA06G078550|TK1151|CDS

ATGGCAGATCTGATCAATCATAGCCCCACCATAACCACAGAAGATTATGCATATGAGATCAAAGGGGCTGGCCTATTCTCCAGGGATCAAATATTCTCTTTGAGAACTCCTATTCCAGTCAAGGCTGGTCAACAGGTCTTGATCCAATATGATTTGAACAAAAGCAATGCCGAATTGGCACTAGATTACGGATTTATCGAATCCACTCCAGACAGAAATACGTACACTTTAACACTACAGATATCGGATTCAGACCCTTA...

Protein

Download Protein FASTA

250 aa · TkA06G078550|TK1151|PROTEIN

MADLINHSPTITTEDYAYEIKGAGLFSRDQIFSLRTPIPVKAGQQVLIQYDLNKSNAELALDYGFIESTPDRNTYTLTLQISDSDPYFDDKLDIAEANGTKAVQYFDITLGRPLPPKMLPYLRLVALGGTDSFLLEAIFRKSVWDHLELPFSRDNEEVICQVVRSACQSALSSYPTTIEEDEKLKGGDVDRRVEIAIGIREGEKKVLGQIDEIFKEREMELDEYEYYQERRLRDLGLVGEQGDIIFWEPK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G078550`
TK1151 ID	TkA06G078550
OH-1004 ID	LXL04_025146
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 52.411 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G078550

Location Chr06:21071114-21073323 (+)

Description Similar to LSMT-L: [Fructose-bisphosphate aldolase]-lysine N-methyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14030`	Protein-lysine methyltransferase methylating chloroplastic fructose 1,6-bisphosphate aldolases.	Characterization of chloroplastic fructose 1,6-bisphosphate aldolases as lysine-methylated proteins in plants.2012 · DOI: 10.1074/jbc.m112.359976

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025146 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008218 bioluminescence Biological Process

GO:0018021 peptidyl-histidine methylation Biological Process

GO:0018023 peptidyl-lysine trimethylation Biological Process

GO:0030047 actin modification Biological Process

GO:0032259 methylation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0070472 regulation of uterine smooth muscle contraction Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ag:AAA69903

ag:AAC49566

ath:AT1G14030

nta:107778201

rno:299295

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.727

Rank 1 · TkA06G078550 · TK1151

Nucleus0.329

Rank 2 · TkA06G078550 · TK1151

Peroxisome0.100

Rank 3 · TkA06G078550 · TK1151

Endoplasmic reticulum0.070

Rank 4 · TkA06G078550 · TK1151

Mitochondrion0.061

Rank 5 · TkA06G078550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09273Rubis-subs-bind83-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G078550	`PF09273`	Rubis-subs-bind	83	207	3.9e-31	109.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI84`	Arabidopsis thaliana	sp\|Q9XI84\|RBCMT_ARATH [Fructose-bisphosphate aldolase]-lysine N-methyltransferase, chloroplastic	70.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card