TkA06G075740 | RubberDandelionOmics

Gene overview

TkA06G075740

Reference: TK1151 Chr: Chr06 Coordinates: 20296087-20299095 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1119 bp · TkA06G075740|TK1151|cDNA

ATTTCTCCATCTGTAATCGATCTCATACACCTTCGTTTCATTCCGTTTTCTCTCTCAAACAATCCCCGAACACAGAAGATTCAGTCTCCCAGTACGATGATTGAATGATCCAAAAAGATCCGCAACACTAATTTCTTCACTATTCAAATTTCTACAAGGAAATCTGAAAAGAAAACGTCCTACATTTTGCAGATTTTCACATCGTAAGGTTTAATTATCTGACAAGATGGCAGGCCAAAGCCAGCGATTGAACGTCGTTC...

CDS

Download CDS FASTA

762 bp · TkA06G075740|TK1151|CDS

ATGGCAGGCCAAAGCCAGCGATTGAACGTCGTTCCAACAACTACAATGCTTGCAGTCGTGAAAGCTCGCCTCATTGGAGCCACAAGAGGCCATGCTCTTTTAAAGAAGAAAAGCGATGCGCTAACCGTCCAATTTCGTCAGATCCTCAGAAAAATCGTCAACACCAAGGAATCAATGGGAACAGTCATGAAATCGTCTTCATTCGCCCTCACTGAAGCGAAGTACGTTGCCGGCGAGAACATCAAACACATCGTTCTAGA...

Protein

Download Protein FASTA

253 aa · TkA06G075740|TK1151|PROTEIN

MAGQSQRLNVVPTTTMLAVVKARLIGATRGHALLKKKSDALTVQFRQILRKIVNTKESMGTVMKSSSFALTEAKYVAGENIKHIVLENVQTASVRVRSRTENVAGVKLPKFDYFTEGEMSKNDLTGLARGGQQIQGCRVAYLKAIEVLVDLASLQTSFLTLDVAIKTTNRRVNALENVVKPRLENTVTYIKGELDELEREDFFRLKKIQAYKKREIALKDAARKLLGDGSSRRGGTLSHANSWSSKKDEDLIF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G075740`
TK1151 ID	TkA06G075740
OH-1004 ID	LXL04_033088
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	84.700
Protein coverage (%)	TK1151 87.747 / OH-1004 88.048 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G075740

Location Chr06:20296087-20299095 (-)

Description Similar to VHA-D: V-type proton ATPase subunit D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58730`	Subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033088 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007035 vacuolar acidification Biological Process

GO:0007042 lysosomal lumen acidification Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0048388 endosomal lumen acidification Biological Process

GO:0051452 intracellular pH reduction Biological Process

GO:0060271 cilium assembly Biological Process

GO:0061512 protein localization to cilium Biological Process

GO:0061795 Golgi lumen acidification Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0000221 vacuolar proton-transporting V-type ATPase, V1 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT3G58730

cal:CAALFM_C406400CA

hsa:51382

ocu:100009221

pon:100172107

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.561

Rank 1 · TkA06G075740 · TK1151

Cell membrane0.209

Rank 2 · TkA06G075740 · TK1151

Lysosome / Vacuole0.149

Rank 3 · TkA06G075740 · TK1151

Nucleus0.135

Rank 4 · TkA06G075740 · TK1151

Endoplasmic reticulum0.115

Rank 5 · TkA06G075740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01813ATP-synt_D17-210 aa

PF25958DUF799525-104 aa

PF25958DUF7995110-139 aa

PF25958DUF7995181-209 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G075740	`PF01813`	ATP-synt_D	17	210	1.9e-66	224.4
TkA06G075740	`PF25958`	DUF7995	25	104	0.14	13.0
TkA06G075740	`PF25958`	DUF7995	110	139	0.14	13.0
TkA06G075740	`PF25958`	DUF7995	181	209	0.14	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XGM1`	Arabidopsis thaliana	sp\|Q9XGM1\|VATD_ARATH V-type proton ATPase subunit D	72.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card