TkA06G075250 | RubberDandelionOmics

Gene overview

TkA06G075250

Reference: TK1151 Chr: Chr06 Coordinates: 20181358-20183236 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1566 bp · TkA06G075250|TK1151|cDNA

TTCAATTCTTTTAAAATAATTAGTAAAGCTAGTGAGTATCCTGAGATTCATTATAACATAGTATTCTACGAACTTTCAGAGGAAAAAAAGCCTGGCGGAAAAGGCAATATATCATACAATGGGGAAACATAATCTCTTTCTGTTTTTCACACATATTTTGGTTTTTATGGTGCCCGTTAATTTTGCTGGTCTGTTTTCTTCACCTGAATCTGGAAACGAAATAGGTGACAACGATGCAGCAATGGATGCATTTATCAATC...

CDS

Download CDS FASTA

1281 bp · TkA06G075250|TK1151|CDS

ATGGGGAAACATAATCTCTTTCTGTTTTTCACACATATTTTGGTTTTTATGGTGCCCGTTAATTTTGCTGGTCTGTTTTCTTCACCTGAATCTGGAAACGAAATAGGTGACAACGATGCAGCAATGGATGCATTTATCAATCCTCATAATCCCGACATGTTCGCAGCAGAGTTTGCCAATGATGACAAAGGCTCAACAAGGAGGGACCTACATACGACATGCGAAGCCACAAACGTAATCGACAAATGCTGGCGTGGCAA...

Protein

Download Protein FASTA

426 aa · TkA06G075250|TK1151|PROTEIN

MGKHNLFLFFTHILVFMVPVNFAGLFSSPESGNEIGDNDAAMDAFINPHNPDMFAAEFANDDKGSTRRDLHTTCEATNVIDKCWRGKSDWAENRQALADCALGFATGTTGGKGGDIYVVTDPSDDDCENPKEGTLRFGVTRDRPLWITFEKDMVITLKHELVIANDKTIDGRGASVEIANGGGLSINKVNNVIIHGIHVHHIKVMDGGKIRSSETKASARSKSDGDAISVFGSTKVWIDHVTLDHGEDGLLDVTMKSTAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G075250`
TK1151 ID	TkA06G075250
OH-1004 ID	LXL04_025208
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G075250`
Location	Chr06:20181358-20183236 (+)
Description	Similar to Pectate lyase 4
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025208` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009664 plant-type cell wall organization Biological Process GO:0045490 pectin catabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005737 cytoplasm Cellular Component GO:0030570 pectate lyase activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	ath:AT1G14420 ath:AT4G13710 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.742

Rank 1 · TkA06G075250 · TK1151

Cytoplasm0.103

Rank 2 · TkA06G075250 · TK1151

Lysosome / Vacuole0.076

Rank 3 · TkA06G075250 · TK1151

Endoplasmic reticulum0.062

Rank 4 · TkA06G075250 · TK1151

Cell membrane0.059

Rank 5 · TkA06G075250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24465Tri-helical65-98 aa

PF00544Pectate_lyase_4157-360 aa

PF13229Beta_helix183-274 aa

PF24465Tri-helical352-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G075250	`PF24465`	Tri-helical	65	98	3.4	8.9
TkA06G075250	`PF00544`	Pectate_lyase_4	157	360	6e-24	85.4
TkA06G075250	`PF13229`	Beta_helix	183	274	0.0031	17.8
TkA06G075250	`PF24465`	Tri-helical	352	369	3.4	8.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card