TkA06G073050 | RubberDandelionOmics

Gene overview

TkA06G073050

Reference: TK1151 Chr: Chr06 Coordinates: 19592946-19594004 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1059 bp · TkA06G073050|TK1151|cDNA

ATGCTCACCACCAGAGCTCTAACGGCCGCACAAGAAGTCGTCCGGTGTCTGTTACCAAGAAGCATCCTCATGCACCCAGATAAAGCTCTGGGTATCCGGGCCACCGTGAGTTTCAGAATGCCCCGTATCCATGGCCGCGCCCACCGTATTTTCCTCCCCTCCGTCGCCAAAATCTCAACTTCAAAACCAACCATTAAAATCAAAAAACACGATCTTTGCGTCTGCACAATGCTATGGAACCAAGCCGACGCAATTCGAGA...

CDS

Download CDS FASTA

1059 bp · TkA06G073050|TK1151|CDS

ATGCTCACCACCAGAGCTCTAACGGCCGCACAAGAAGTCGTCCGGTGTCTGTTACCAAGAAGCATCCTCATGCACCCAGATAAAGCTCTGGGTATCCGGGCCACCGTGAGTTTCAGAATGCCCCGTATCCATGGCCGCGCCCACCGTATTTTCCTCCCCTCCGTCGCCAAAATCTCAACTTCAAAACCAACCATTAAAATCAAAAAACACGATCTTTGCGTCTGCACAATGCTATGGAACCAAGCCGACGCAATTCGAGA...

Protein

Download Protein FASTA

352 aa · TkA06G073050|TK1151|PROTEIN

MLTTRALTAAQEVVRCLLPRSILMHPDKALGIRATVSFRMPRIHGRAHRIFLPSVAKISTSKPTIKIKKHDLCVCTMLWNQADAIREWITYHSFLGVQNWFIYDNNSDDKIKDVIKNLNLEGYNISRHIWPWIKTQEAGFSHCAMRARTVCNWVSFMDVDEFYHFPPLTSTIANPQGSLLSLVSNFTSSSSIGEIRTSCHSFGPSGLTSRPKKGVTVGYTCRLQSPERHKSIIRPDALDLTLMNVVHHFHLKKGFTFMDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G073050`
TK1151 ID	TkA06G073050
OH-1004 ID	LXL04_013241
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	51.600
Protein coverage (%)	TK1151 99.432 / OH-1004 62.316 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G073050

Location Chr06:19592946-19594004 (+)

Description Similar to RCOM_0530710: Glycosyltransferase family 92 protein RCOM_0530710

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27200`	Glycosyltransferase family 92 protein At1g27200.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0121900`	Glycosyltransferase family 92 protein Os08g0121900.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013241 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000138 Golgi trans cisterna Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0016020 membrane Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G27200

dosa:Os08g0121900

rcu:8270359

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.736

Rank 1 · TkA06G073050 · TK1151

Endoplasmic reticulum0.100

Rank 2 · TkA06G073050 · TK1151

Extracellular0.062

Rank 3 · TkA06G073050 · TK1151

Cytoplasm0.054

Rank 4 · TkA06G073050 · TK1151

Cell membrane0.051

Rank 5 · TkA06G073050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01697Glyco_transf_9272-294 aa

PF04381RdgC97-118 aa

PF04381RdgC211-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G073050	`PF01697`	Glyco_transf_92	72	294	5.6e-37	128.4
TkA06G073050	`PF04381`	RdgC	97	118	0.37	10.8
TkA06G073050	`PF04381`	RdgC	211	254	0.37	10.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94K98`	Arabidopsis thaliana	sp\|Q94K98\|Y1720_ARATH Glycosyltransferase family 92 protein At1g27200	62.200%	Swiss-Prot	High
`Q6YRM6`	Oryza sativa subsp. japonica	sp\|Q6YRM6\|Y8219_ORYSJ Glycosyltransferase family 92 protein Os08g0121900	52.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card