TkA06G067690 | RubberDandelionOmics

Gene overview

TkA06G067690

Reference: TK1151 Chr: Chr06 Coordinates: 18110060-18113567 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · TkA06G067690|TK1151|cDNA

ACAATTATAGTACCATGAAACATTAATGTACATCTTCAGTCAGAGGACTGAATTTGCATACCAACAGATACTCAAGATACCATTTTTGCAATTGTTCCTTTTATTTTTGGAAATAATCTATGTTTCCTTTGTACAAATCTAAAACATTTTGAAAAGGACTTTGGTGGGCACGTCGATACTAGACTCGTCCGTTATTTGACATATAGTGGACATGTGGACTTTTGTTTATGTCCGAAATAGTTCGCCCTTTCATTTTAGCC...

CDS

Download CDS FASTA

1617 bp · TkA06G067690|TK1151|CDS

ATGGGTGTAATCAGTACTATTTTGGGGTTTTCTGGCTTTGGAATCGGCGTTTCTGCTGGGCTTGTGATCGGTTATTATTTCTTCATCTACTTTCAACCCACAGATGTCAAGGATCCAGTTATTCGTCCTTTGGTCGAAAGAGACTCGGAAACTCTACAAAGTATGCTCCCTGAGATACCGGCGTGGGTAAAAAGTCCGGATTTTGACCGGGTTGATTGGCTTAACAAGTTCATCGAATATATGTGGCCGTATCTCGACAA...

Protein

Download Protein FASTA

538 aa · TkA06G067690|TK1151|PROTEIN

MGVISTILGFSGFGIGVSAGLVIGYYFFIYFQPTDVKDPVIRPLVERDSETLQSMLPEIPAWVKSPDFDRVDWLNKFIEYMWPYLDKAICKTAKEIAKPIIAEQIPKYKIDSVEFETLSLGSLPPTFQGMKVYVTDEKELIMEPSLKWAGNPNVTVAAKAFGLKATVQVIDLQVFAAPRITLKPLVPSFPCFAKICVSLMEKPHVDFGLRLFGADLMSIPGLYRFVQEQIKDQVANMYLWPRTLEVQILDPSKALKKPVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G067690`
TK1151 ID	TkA06G067690
OH-1004 ID	LXL04_022314
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	71.600
Protein coverage (%)	TK1151 99.814 / OH-1004 99.814 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G067690

Location Chr06:18110060-18113567 (-)

Description Similar to SYT2: Synaptotagmin-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20990`	Plays an important role in maintaining plasma membrane integrity during freezing and osmotic stresses.	Arabidopsis synaptotagmin 1 is required for the maintenance of plasma membrane integrity and cell viability.2008 · DOI: 10.1105/tpc.108.063859 Calcium-dependent freezing tolerance in Arabidopsis involves membrane resealing via synaptotagmin SYT1.2008 · DOI: 10.1105/tpc.108.062679 Arabidopsis synaptotagmin SYTA regulates endocytosis and virus movement protein cell-to-cell transport.2010 · DOI: 10.1073/pnas.0909080107 Arabidopsis synaptotagmin SYT1, a type I signal-anchor protein, requires tandem C2 domains for delivery to the plasma membrane.2010 · DOI: 10.1074/jbc.m109.084046
`At1g20080`	May play an important role in regulating an unconventional protein trafficking from the cytosol to the extracellular matrix.	Golgi apparatus-localized synaptotagmin 2 is required for unconventional secretion in Arabidopsis.2011 · DOI: 10.1371/journal.pone.0026477
`At5g04220`	May be involved in membrane trafficking.	No verified direct reference in this release
`At3g61050`	May be involved in membrane trafficking (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022314 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0006869 lipid transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0009306 protein secretion Biological Process

GO:0009409 response to cold Biological Process

GO:0009612 response to mechanical stimulus Biological Process

GO:0009615 response to virus Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0046740 transport of virus in host, cell to cell Biological Process

GO:0061817 endoplasmic reticulum-plasma membrane tethering Biological Process

GO:0000139 Golgi membrane Cellular Component

KEGG gene cross-reference

ath:AT1G05500

ath:AT1G20080

ath:AT2G20990

ath:AT5G04220

ath:AT5G11100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.683

Rank 1 · TkA06G067690 · TK1151

Cytoplasm0.276

Rank 2 · TkA06G067690 · TK1151

Endoplasmic reticulum0.167

Rank 3 · TkA06G067690 · TK1151

Nucleus0.103

Rank 4 · TkA06G067690 · TK1151

Golgi apparatus0.087

Rank 5 · TkA06G067690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17047SMP_LBD67-247 aa

PF25669SMP_MUG190-like70-137 aa

PF18697MLVIN_C129-157 aa

PF25669SMP_MUG190-like173-248 aa

PF00168C2260-359 aa

PF18697MLVIN_C302-323 aa

PF10622Ehbp315-351 aa

PF00513Late_protein_L2337-443 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G067690	`PF17047`	SMP_LBD	67	247	1.4e-17	64.5
TkA06G067690	`PF25669`	SMP_MUG190-like	70	137	6.7e-14	52.7
TkA06G067690	`PF18697`	MLVIN_C	129	157	0.0045	17.4
TkA06G067690	`PF25669`	SMP_MUG190-like	173	248	6.7e-14	52.7
TkA06G067690	`PF00168`	C2	260	359	2.6e-44	150.4
TkA06G067690	`PF18697`	MLVIN_C	302	323	0.0045	17.4
TkA06G067690	`PF10622`	Ehbp	315	351	0.056	14.2
TkA06G067690	`PF00513`	Late_protein_L2	337	443	0.056	13.2
TkA06G067690	`PF00168`	C2	417	520	2.6e-44	150.4
TkA06G067690	`PF18697`	MLVIN_C	417	442	0.0045	17.4
TkA06G067690	`PF18697`	MLVIN_C	451	472	0.0045	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SKR2`	Arabidopsis thaliana	sp\|Q9SKR2\|SYT1_ARATH Synaptotagmin-1	75.000%	Swiss-Prot	High
`B6ETT4`	Arabidopsis thaliana	sp\|B6ETT4\|SYT2_ARATH Synaptotagmin-2	73.700%	Swiss-Prot	High
`Q7XA06`	Arabidopsis thaliana	sp\|Q7XA06\|SYT3_ARATH Synaptotagmin-3	54.600%	Swiss-Prot	High
`Q9LEX1`	Arabidopsis thaliana	sp\|Q9LEX1\|CLB_ARATH Calcium-dependent lipid-binding protein	33.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card