TkA06G065070 | RubberDandelionOmics

Gene overview

TkA06G065070

Reference: TK1151 Chr: Chr06 Coordinates: 17505365-17506648 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1207 bp · TkA06G065070|TK1151|cDNA

ACGCACCCAATGTGTGTATATAAACCAACATCAATAATAAACTTTTCATCTCGCCCTTTTGCTTAAATACAATCTTTTTAAAAAAAAGTGGAGAGAGATGACAACCAAATCAAGTGTCGGAAAAGCCAACATCTTGGCTCTTGGGAAAGCTTTCCCTCACCAACTTGTTATGCAAGACCTACTTGTTGAAGGCTATTTTAAGGATACCAATTGTGACGACCCCGAACTCAAACAAAAGCTCACTCGACTATGCAAAACTA...

CDS

Download CDS FASTA

1110 bp · TkA06G065070|TK1151|CDS

ATGACAACCAAATCAAGTGTCGGAAAAGCCAACATCTTGGCTCTTGGGAAAGCTTTCCCTCACCAACTTGTTATGCAAGACCTACTTGTTGAAGGCTATTTTAAGGATACCAATTGTGACGACCCCGAACTCAAACAAAAGCTCACTCGACTATGCAAAACTACATGTGTGAAAACAAGGTATGTTGTTATGTCGCAAGAGATACTCGAGAAATACCCCGAATTAGCACTCGAAGGCCTCCCGACAGTCAGACAAAGACT...

Protein

Download Protein FASTA

370 aa · TkA06G065070|TK1151|PROTEIN

MTTKSSVGKANILALGKAFPHQLVMQDLLVEGYFKDTNCDDPELKQKLTRLCKTTCVKTRYVVMSQEILEKYPELALEGLPTVRQRLDIANKAVTQMAIEASQECIKKWARPISDITHLVYVSSSEARLPGGDIYLAKGLGLSPNTHRVLLYFSGCSGGVAGLRVAKDIAEKHPGSRVLLATAETTIVGYKPPSVNRPYDLVGVALFGDGAGAMMIGANPIGPERPLFELHTAIQNFLPDTEKTIDGRLTEEGISFRLDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G065070`
TK1151 ID	TkA06G065070
OH-1004 ID	LXL04_022777
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	64.700
Protein coverage (%)	TK1151 98.108 / OH-1004 91.327 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G065070

Location Chr06:17505365-17506648 (-)

Description Similar to PKSA: Type III polyketide synthase A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34850`	Plant type III polyketide synthases (PKSs) that catalyzes the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products including long-chain alkyl alpha-pyrones.	Structure function analysis of novel type III polyketide synthases from Arabidopsis thaliana.2008 · DOI: 10.1248/bpb.31.2205 LAP5 and LAP6 encode anther-specific proteins with similarity to chalcone synthase essential for pollen exine development in Arabidopsis.2010 · DOI: 10.1104/pp.110.157446 LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B encode hydroxyalkyl α-pyrone synthases required for pollen development and sporopollenin biosynthesis in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.080028
`At1g02050`	Plant type III polyketide synthases (PKSs) that catalyzes the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products including long-chain alkyl alpha-pyrones.	Structure function analysis of novel type III polyketide synthases from Arabidopsis thaliana.2008 · DOI: 10.1248/bpb.31.2205 LAP5 and LAP6 encode anther-specific proteins with similarity to chalcone synthase essential for pollen exine development in Arabidopsis.2010 · DOI: 10.1104/pp.110.157446 LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B encode hydroxyalkyl α-pyrone synthases required for pollen development and sporopollenin biosynthesis in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.080028
`At4g00040`	Plant type III polyketide synthases (PKSs) that catalyzes the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products including long-chain alkyl alpha-pyrones.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0411300`	Plant type III polyketide synthases (PKSs) that catalyzes the condensation of fatty acyl-CoA with malonyl-CoA to generate triketide and tetraketide alpha-pyrones, the main components of pollen exine and potential sporopollenin precursors.	The polyketide synthase OsPKS2 is essential for pollen exine and Ubisch body patterning in rice.2017 · DOI: 10.1111/jipb.12574 OsPKS2 is required for rice male fertility by participating in pollen wall formation.2018 · DOI: 10.1007/s00299-018-2265-x
`Os10g0484800`	Plant type III polyketide synthases (PKSs) that catalyzes the condensation of fatty acyl-CoA with malonyl-CoA to generate triketide and tetraketide alpha-pyrones, the main components of pollen exine and potential sporopollenin precursors.	Conserved metabolic steps for sporopollenin precursor formation in tobacco and rice.2013 · DOI: 10.1111/ppl.12018

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022777 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009813 flavonoid biosynthetic process Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0030639 polyketide biosynthetic process Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups Molecular Function

GO:0090439 tetraketide alpha-pyrone synthase activity Molecular Function

KEGG gene cross-reference

ath:AT1G02050

ath:AT4G00040

ath:AT4G34850

dosa:Os07g0411300

dosa:Os10g0484800

osa:4343009

osa:4348937

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.292

Rank 1 · TkA06G065070 · TK1151

Peroxisome0.284

Rank 2 · TkA06G065070 · TK1151

Endoplasmic reticulum0.262

Rank 3 · TkA06G065070 · TK1151

Mitochondrion0.110

Rank 4 · TkA06G065070 · TK1151

Nucleus0.087

Rank 5 · TkA06G065070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00195Chal_sti_synt_N4-220 aa

PF08392FAE1_CUT1_RppA85-236 aa

PF08545ACP_syn_III155-219 aa

PF07992Pyr_redox_2158-193 aa

PF02797Chal_sti_synt_C229-370 aa

PF07992Pyr_redox_2235-270 aa

PF08541ACP_syn_III_C295-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G065070	`PF00195`	Chal_sti_synt_N	4	220	2.6e-93	312.3
TkA06G065070	`PF08392`	FAE1_CUT1_RppA	85	236	0.0015	18.6
TkA06G065070	`PF08545`	ACP_syn_III	155	219	2.1e-06	28.3
TkA06G065070	`PF07992`	Pyr_redox_2	158	193	0.17	12.0
TkA06G065070	`PF02797`	Chal_sti_synt_C	229	370	3e-53	180.6
TkA06G065070	`PF07992`	Pyr_redox_2	235	270	0.17	12.0
TkA06G065070	`PF08541`	ACP_syn_III_C	295	370	0.011	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDM2`	Arabidopsis thaliana	sp\|Q8LDM2\|PKSB_ARATH Type III polyketide synthase B	76.500%	Swiss-Prot	High
`O23674`	Arabidopsis thaliana	sp\|O23674\|PKSA_ARATH Type III polyketide synthase A	64.000%	Swiss-Prot	High
`O81305`	Arabidopsis thaliana	sp\|O81305\|PKSC_ARATH Type III polyketide synthase C	62.100%	Swiss-Prot	High
`Q8H305`	Oryza sativa subsp. japonica	sp\|Q8H305\|PKS10_ORYSJ Type III polyketide synthase 10	68.400%	Swiss-Prot	High
`A3C5V6`	Oryza sativa subsp. japonica	sp\|A3C5V6\|PKS21_ORYSJ Type III polyketide synthase 21	58.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card